El receptor activat de c-kit al cor afavoreix la reparació i regeneració cardíaca després de lesions | mort i malaltia cel·lular

El receptor activat de c-kit al cor afavoreix la reparació i regeneració cardíaca després de lesions | mort i malaltia cel·lular

Anonim

Temes

  • Regeneració cardíaca
  • Malalties cardiovasculars
  • Mort cel·lular
  • Diferenciació de cèl·lules mare

Resum

El paper de l’activació endògena del receptor c-Kit en l’homeòstasi i reparació de cèl·lules cardíaques continua essent en gran mesura inexplorat. Es van generar ratolins transgènics que portaven una mutació de punt d’activació (TgD814Y) al domini cinasa del gen c-Kit . El receptor c-Kit TgD814Y es va expressar al cor durant el desenvolupament embrionari i la vida postnatal, en un patró de sincronització i expressió similar al del gen endogen, però no al compartiment hematopoètic que permet l'estudi d'un fenotip específic per a cardíacs. La mutació c-Kit TgD814Y va produir un receptor actiu constitutiu de c-Kit en teixit cardíac i cèl·lules a partir de ratolins transgènics, tal com es demostra amb la fosforilació augmentada d’ERK1 / 2 i AKT, que són els principals efectors moleculars a la baixa de la senyalització del receptor c-Kit. En els cors transgènics adults, la morfologia cardíaca, la mida i el nombre total de c-Kit + de cèl·lules cardíaques no eren diferents en comparació amb els ratolins wt. No obstant això, quan els ratolins c-Kit TgD814Y van ser afectats per crioinjury (CI) a danys cardíacs necrosos transmurals, tots els transgènics van sobreviure, en comparació amb la meitat dels ratolins. A la fase sub-aguda després de la CI, els ratolins transgènics i els dos van mostrar danys cardíacs similars. No obstant això, 9 dies després de la CI, els ratolins transgènics van mostrar un nombre més gran de c-Kit + CD31 + cèl·lules progenitores endotelials que envolten la zona necròtica. En el seguiment posterior, es va observar una reducció constant de la zona fibròtica, augment de la densitat capil·lar i augment de la taxa de reposició de cardiomiòcits (establerta per la incorporació de BrdU) en transgènics en comparació amb ratolins. De forma consistent, les cèl·lules mare c-Kit + c-Kit + aïllades dels ratolins transgènics C-Kit TgD814Y van mostrar un potencial de diferenciació endotelial i cardiomiòcit augmentat en comparació amb cèl·lules aïllades del pes. L’activació constitutiva del receptor de c-Kit en ratolins s’associa amb un potencial reparatiu miogen i vasculogènic cardíac augmentat després de la lesió, amb una millora significativa de la supervivència.

Principal

c-Kit és un receptor de tirosina quinasa essencial per a la proliferació, la supervivència i la migració de diversos tipus de cèl·lules mare com ara precursors de melanòcits, cèl·lules mare hematopoietiques i germinals. 1, 2, 3, 4 Més recentment, es va expressar que el receptor de c-Kit estava expressat en cèl·lules mare cardíaques i neuronals. 5, 6 ratolins que mancaven del gen c-Kit presenten defectes de cèl·lules germinals i melanòcits i moren els primers dies de la vida postnatal a causa d’una hematopoiesi deteriorada. 7, 8 La unió del ligand c-Kit (KL) indueix homodimerització del receptor i autofosforilació dels dominis de tirosina quinasa intracel·lular que condueixen a la modulació de diferents vies de senyalització com AKT i MAPKs. 9, 10, 11

En els darrers 15 anys, diversos estudis han demostrat que c-Kit + cèl·lules mare cardíaques (CSC) tenen efectes beneficiosos en la reparació i regeneració cardíaca. 12 Els ratolins genèticament mutants amb deficiència en la senyalització de c-Kit ( W / Wv ) mostren una remodelació cardíaca empitjorada després de l’infart de miocardi, de forma inversa els ratolins transgènics que sobreexpressen KL al cor presenten una reparació del miocardi millorada en comparació amb els seus càlculs posteriors després d’un infart de miocardi. 13, 14, 15 La major expressió de KL que es produeix en un cor isquèmic afavoreix la migració de c-Kit + derivat de medul·la òssia i CSCs mitjançant l’activació de MAPK p38. 16, 17, 18 A més, recentment s’han utilitzat c-Kit + CSC en el tractament de pacients amb cardiomiopatia isquèmica i insuficiència cardíaca amb una millora significativa de la funció sistòlica i una reducció de la mida de l’infart. 19, 20, 21

Tot i que el c-Kit s’utilitza àmpliament com a “marcador de superfície cel·lular” per identificar cèl·lules mare tant del cor embrionari com del adult, 22, 23 poca informació 14, 15 està disponible sobre la funció que té la senyalització de c-Kit en l’activació de CSC en reparació cardíaca.

Per investigar el paper del c-Kit en la reparació del cor, es van generar ratolins transgènics portant una versió mutada del gen c-Kit . La substitució de la tirosina per l’àcid aspartic 814 al domini fosfotransferasa condueix a l’activació constitutiva del receptor. Disminució de l’àrea fibròtica als cors criomilitats, reducció de cèl·lules mieloides inflamatòries a la sang, augment del nombre de c-Kit + CD31 + cèl·lules endotelials i capil·lars amb etiqueta B4 (IB-4), així com cardiomiòcits de nova formació positius BrdU en zona cardíaca danyada de ratolins transgènics es van observar. L’activació MAPK i AKT es va millorar significativament en els cors i CSCs de ratolins transgènics, de manera que les dues cinases modulen l’activació i la diferenciació endotelial / miogènica de CSCs. En general, aquestes dades indiquen que el receptor del c-Kit activat exerceix un rol protector / regenerador beneficiós per al teixit miocàrdic després de lesions millorant la remodelació i reparació cardíaca, alhora que fomenten la diferenciació de cèl·lules progenitores cardíaques probables a causa de l'activació de la senyalització MAPK i AKT.

Resultats

Generació de ratolins transgènics que expressen al cor un receptor de c-Kit activat

Per generar ratolins transgènics que expressen un receptor c-Kit activat constitutivament, es va utilitzar un mètode de reconstitució del cromosoma artificial bacterial (BAC) que permet la transcripció del gen c-Kit mitjançant seqüències reguladores endògenes (Figura 1).

Image

La substitució D814Y indueix una activació constitutiva de c-Kit. ( a ) Alineacions locals paral·leles a les seqüències de proteïna c-Kit de l'humà ( Homo sapiens ) i del ratolí ( Mus musculus ) que envolten el residu putatiu per a l'activació constitutiva en el segon domini de la cinasa del receptor. ( b ) Seqüència de cromatograma que mostra l'àcid aspartic a la mutació de la tirosina introduïda en el ratolí c-Kit BAC RP23- 309C11. ( c ) WB i densitometria de l’expressió de c-Kit en cors recollits d’embrions en diferents etapes de desenvolupament. La proteïna mutant c-Kit s’expressa 2, 5 vegades superior al nivell endògena en els embrions c-Kit TgD814Y c-Kit +/− . ( d ) WB i densitometria de l’expressió de c-Kit en el lisat cardíac total recollit de ratolins neonatals. La proteïna mutant c-Kit s’expressa 2, 5 vegades superior als nivells de proteïna c-Kit endògena en c-Kit TgD814Y c-Kit +/− ratolins. L'activació de c-Kit es mostra per un anticòs pan-fosforo-tirosina que reconeix una banda específica a l'alçada del receptor. ( e ) Anàlisi del WB sobre cors recollits de ratolins de 7 dpp. Les dades s’obtenen a partir d’almenys tres cors separats i es reporten ± SD; ** P <0, 01, *** P <0, 001. ( f ) Anàlisi d'immunofluorescència de cèl·lules c-Kit + (vermelles) en miòcits neonatals aïllats de c-Kit TgD814Y cultivats durant 24 hores co-tacades amb MEF2C (verd) i MF20 (verd). Es van contrarestar nuclis (blaus) amb Hoechst 33342. Barres d’escala 30 μ m

Imatge a mida completa

En humans, es va trobar que l’aminoàcid aspartic 816 del segon domini cinasa de c-Kit es substituïa amb mutacions activadores en diversos tumors (figura 1a). 24, 25, 26 El corresponent residu aspartic murí 814, per tant, va ser mutat amb èxit a la tirosina (D814Y) al BAC del ratolí (RP23-309C11), tal com es confirma per anàlisi de seqüències (Figures 1a). El BAC resultant es va utilitzar posteriorment per generar ratolins transgènics. Es van produir diverses línies fundadores, dues de les quals (Tg7 i Tg8) van transmetre i expressar de manera similar el receptor actiu constitutiu de c-Kit (c-Kit TgD814Y ).

Els ratolins transgènics van ser creuats amb ratolins de tipus salvatge c-Kit ( c-Kit + / + ) o heterozigots c-Kit ( c-Kit + / - ). En casos embrionaris (figura 1c) i neonatal (figura 1d i figura 2b) els cors de ratolins transgènics van expressar el receptor 2, 5 vegades més alt en comparació amb els ratolins control, indicant que l'expressió de proteïna c-Kit TgD814Y era similar als nivells endògens del receptor del c-Kit. + / + ratolins. A una setmana d’edat, el receptor de c-Kit es podia detectar fàcilment mitjançant l’anàlisi de Western Blotting (WB) en els liatats cardíacs totals de c-Kit TgD814Y c-Kit +/- ratolins, però no de ratolins c-Kit +/- només es va detectar per immunoprecipitació (figura 1e, figura suplementària 1A). Per verificar si la introducció de la mutació D814Y va induir l’activació del receptor c-Kit, es va fer servir en els anàlisis del WB un anticòs pan contra la fosfo-tirosina, que permetia la detecció de tots els llocs d’autofosforilació del receptor putatiu. Les figures 1d i e mostren un augment de la fosforilació de la tirosina en una banda de proteïnes corresponent al receptor c-Kit dels cors transgènics en comparació amb els cors heterozigots. Aquests resultats es van confirmar en cors de ratolins c-Kit TgD814Y c-Kit + / + (figura 2c i dades no mostrades). Per caracteritzar més l’expressió transgènica, es van obtenir cèl·lules cardíaques neonatales aïllades dels ratolins c-Kit TgD814Y c-Kit +/- ratos i es van cultivar durant 24 hores abans de la tinció d’immunofluorescència. La figura 1f mostra que el c-Kit s’expressa en els progenitors de miocits tal i com es revela per la co-tinció amb el marcador MEF2C (Figura 1f, panells superiors) però no en miòcits diferenciats terminalment com es mostra en la tinció MF20 (Figura 1f, panells inferiors). Aquests resultats mostren que l'expressió del receptor activat constitutivament no va impedir la diferenciació normal del miocit i no va induir l'expressió ectòpica de c-Kit en miocits diferenciats. També es va observar l'expressió i l'activació de proteïnes transgèniques en testicles i cerebel a diferents edats (figura suplementària 1B). Aquestes dades confirmen que la transcripció del gen c-Kit , amb mètode de reconstitució BAC, es va produir sota mecanismes reguladors endògens en aquests tipus cel·lulars.

Image

Activació MAPK i AKT en cors transgènics c-Kit TgD814Y . ( a ) Els cors i els fetges del c-Kit TgD814Y c-Kit - / - i c-Kit - / - E15.5 es van aïllar i es van analitzar extractes de proteïnes per a la fosforilació AKT i MAPK. Els substrats fosforilats es van augmentar en cors embrionaris a partir de ratolins transgènics. ( b ) Anàlisi de WB sobre extractes de proteïnes de c-Kit TgD814Y c-Kit + / + i c-Kit + / + 3 dpp de cors de dos animals diferents. Es reconeix la densitometria de l’expressió de c-Kit, la fosforilació MAPK i AKT. Les dades es denuncien com a mitjana de tres cors ± SD; * P <0, 05, ** P <0, 01, *** P <0, 001. ( c ) Cèl·lules cardíaques neonatals aïllades de c-Kit TgD814Y c-Kit + / + i c-Kit + / + 3 dpp es van estimular amb 100 ng / ml de KL durant 10 min i extractes de proteïna processats per a la fosforilació AKT i MAPK. Es reporta una densitometria de sis experiments separats. Les dades es reporten ± SD; * P <0, 05, ** P <0, 01

Imatge a mida completa

El receptor activat del c-Kit TgD814Y no s’expressa en compartiments hematopoètics

Els ratolins eliminatoris c-Kit moren després del part a causa d'un deteriorament greu de l'hematopoiesi. No es va detectar la proteïna del receptor c-Kit mutada i constitutivament activa a la medul·la òssia per WB i anàlisis de citometria de flux (Figs suplementàries 1C i D). Això podria reflectir l'absència d'expressió de la construcció de BAC dins de les cèl·lules hematopoietiques de la medul·la. 27

Per estudiar àmpliament l’expressió del transgene c-Kit TgD814Y en compartiments hematopoètics, hem generat ratolins deficients c-Kit (c-Kit - / - ; Figura suplementària 1E) i els hem reconstituïts amb el transgene ( c-Kit TgD814Y c -Kit - / - ). Igualment amb els embrions i els nounats c-Kit , els c-Kit TgD814Y c-Kit - / - els cadells eren extremadament anèmics, menors que els seus camins i tots van morir abans de néixer (figura suplementària 1E), cosa que indica que el transgene no rescata la fenotip letal de ratolins eliminadors de c-Kit . La letalitat dels ratolins c-Kit TgD814Y c-Kit - / - va ser causada per la manca d’expressió transgènica en el fetge fetal. Es va observar una expressió marginal c-Kit, insuficient per rescatar el fenotip, tant als c-Kit c / Kit TgD814Y c-Kit - / - fetges de la E15.5, probablement a causa de l'estratègia utilitzada per al c-Kit - / - generació del ratolí (Figures suplementàries 1F i G i secció de mètodes). Per contra, les anàlisis d'immunofluorescència van revelar l'expressió transgènica de c-Kit en el c-Kit embrionari TgD814Y c-Kit - / - teixit cardíac, mentre que, com era d'esperar, no es va observar cap expressió en cap dels embrions c-Kit - / - (figura suplementària 1F). L'expressió transgènica c-Kit al cor que no sigui al cap, a l'arc branquial ia l'estómac també es va observar en èpoques anteriors de desenvolupament (figura suplementària 1G). Aquestes observacions amplien el coneixement de l’expressió de c-Kit fins al desenvolupament cardíac precoç 28, 29 i també assenyalen la noció important que el transgene c-Kit TgD814Y s’expressa al cor, però no en teixits hemopoètics fetals i adults. Així, aquest model de ratolí transgènic ofereix un avantatge únic respecte als models de ratolí anteriors, ja que no exclou que qualsevol fenotip cardíac sigui secundari al receptor c-Kit activat dins de les cèl·lules de la medul·la òssia.

El receptor activat de c-Kit indueix la fosforilació ERK1 / 2 i AKT

La senyalització aigües avall del receptor c-Kit implica principalment vies MAPK i PI3K. 10, 11, 30 Per avaluar si aquestes vies van ser activades en els ratolins c-Kit TgD814Y, es van avaluar els extractes de proteïnes del cor c-Kit TgD814Y c-Kit C / Kit - / - i c-Kit - / - del fetge integral i del cor. ERK1 / 2 i fosforilació AKT (Figura 2a). No es van observar nivells diferents de fosforilació de ERK1 / 2 i AKT en extractes hepàtics del c-Kit TgD814Y c-Kit - / - en comparació amb ratolins eliminadors (figura 2a), com s'esperava per l'absència de l'expressió transgènica al fetge (figura suplementària 1F ). Per contra, es van observar en mostres cardíaques de ratolins c-Kit TgD814Y c-Kit - / - , un petit però important augment de la fosforilació AKT i un fort augment de la fosforilació ERK1 / 2 en comparació amb els ratolins c-Kit - / - (Figura 2a) . Es van observar increments similars de fosforilació ERK1 / 2 i AKT en els llicats cardíacs totals de ratolins de 3 dpp c-Kit TgD814Y c-Kit + / + + en comparació amb els ratolins c-Kit + / + (figura 2b). A més, la fosforilació més alta d’ERK1 / 2 i AKT també es va observar en c-Kit transgènic TgD814Y c-Kit + / + en comparació amb c-Kit + / + preparacions de cèl·lules cardíaques recentment aïllades (Figura 2c). Curiosament, l'activació de c-Kit pel seu lligand endògena (KL) indueix la fosforilació ERK1 / 2 i AKT en cèl·lules aïllades dels cors en pes fins al nivell detectat en cèl·lules del transgene. A més, KL no va poder augmentar més el nivell de fosforilació ERK1 / 2 i AKT en cèl·lules c-Kit + cardíaques aïllades d’animals transgènics (figura 2c). Aquests resultats demostren que les vies MAPK i PI3K s’activen en cors de ratolins c-Kit TgD814Y imitant estimulació de lligands endògens. El pretractament amb Imatinib va ​​poder prevenir l'estimulació de KL de cèl·lules en pes, confirmant la selectivitat de l'activació del sistema c-Kit / KL (figura suplementària 2A). Com era d’esperar, Imatinib no va afectar les cèl·lules c-Kit TgD814Y, a causa dels canvis conformacionals induïts per la mutació que modifica el domini catalític (figura suplementària 2A).

Finalment, com a prova de principi de l’activació constitutiva del receptor c-Kit TgD814Y, els ratolins transgènics que expressen una versió en pes del receptor c-Kit (c-Kit TgWT ) del BAC RP23-309C11 original es van creuar als ratolins C57 / BL6 per avaluació de l’expressió i l’activació de c-Kit. Tal com es mostra a la figura suplementària 2B, els analitzadors de WB van detectar els cors de ratolins TgWT c-Kit que van expressar el doble de la quantitat de receptors en comparació amb els camins de control, però no es van detectar diferències en l’autofosforilació ni en les vies de senyalització ERK1 / 2 i AKT activades.

L’expressió del receptor c-Kit activat no afecta el desenvolupament i la morfologia cardíaca

Per avaluar els efectes de l’activació del receptor c-Kit sobre el teixit i l’estructura cardíaca, primer vam establir si l’activació constitutiva de c-Kit afectava el nombre de cèl·lules c-Kit + cardíacs totals en ratolins mutants c-Kit TgD814Y . Per simplificar la lectura de l’immunohistoquímica quantitativa i l’anàlisi de FACS, hem creuat ratolins mutants c-Kit TgD814Y amb ratolins transgènics que expressen EGFP sota les seqüències reguladores del promotor c-Kit ( pKit EGFP ). 31, 32

En c-Kit TgD814Y pKit EGFP doble cor transgènic, la majoria (més del 95%) de cèl·lules que expressen c-Kit identificades per la tinció amb un anticorpi anti-c-Kit co-expressat proteïna EGFP (figura 3a). L'anàlisi histològica de la secció cardíaca de ratolins a 1 dpp, 10 dpp i 2 mesos va demostrar que les cèl·lules c-Kit + EGFP + es van distribuir al llarg de l'epicardi, repartides al miocardi i menys freqüentment agrupades a l'endocardi. És important destacar que el nombre de cèl·lules EGFP + era comparable en els c-Kit TgD814Y pKit cors EGFP i pKit EGFP en tots els moments (figura 3b). A més, la densitat capil·lar del miocardi i les mides de miòcits eren similars entre els cors c-Kit TgD814Y pKit EGFP i pKit EGFP (dades no mostrades). Així, aquestes dades mostren que el receptor de c-Kit activat constitutiu no canvia el nombre total de c-Kit + cèl·lula, la vascularització del miocardi i el creixement del miocit durant el desenvolupament i l’homeòstasi de cèl·lules adultes, almenys a l’edat investigada.

Image

La distribució de c-Kit + de cèl·lules cardíaques no es veu afectada per la mutació c-Kit TgD814Y in vivo . ( a ) Immunofluorescència en seccions del cor preparades a partir de 1 dpp, 10 dpp i c-Kit adult TGD814Y pKit ratolins EGFP que presenten intramiocardi (1 dpp i adult) i peri-vasal (10 dpp) localització de cèl·lules c-Kit + . Els insertos mostren co-expressió c-Kit (vermell) i EGFP (verd). Barres d’escala 30 μ M. ( b ) Nombre de cèl·lules EGFP + en c-Kit TgD814Y pKit EGFP versus pKit ratolins EGFP a 1 dpp, 10 dpp i Adult. Es van analitzar almenys 20 seccions per a cada cor ( n = 3 ratolins per a cada edat i genotip). Es va seccionar tot el cor i es va analitzar per a ratolins d'1 dpp. Les dades es reporten ± SE; * P <0, 05

Imatge a mida completa

L’expressió del receptor c-Kit activat millora la reparació cardíaca després de lesions

Per a desafiar el paper de les cèl·lules c-Kit activades en la reparació del miocardi, es va induir dany ventricular per crioinjury (CI) en cors de ratolins transgènics i de dos mesos (figura 4). Es va avaluar la supervivència animal, la inflamació sistèmica i la remodelació del teixit cardíac per valorar la recuperació després de lesions cardíaques.

Image

Increment de la supervivència i reducció de fibrosi cardíaca en mutants c-Kit TgD814Y després de la CI. ( a ) Anàlisi de supervivència de Kaplan – Meier en ratolins c-Kit + / + ( n = 20) i c-Kit TgD814Y ( n = 12). La supervivència dels ratolins c-Kit TgD814Y va ser estadísticament significativa en comparació amb c-Kit + / + 5 dies després de la lesió (100% c-Kit TgD814Y enfront del 57% en pes). Els ratolins que van morir durant la cirurgia no es van considerar per a la corba de supervivència. ( b ) Cronologia que mostra mostres de sang abans i després de la recollida de IC i cors. La regeneració del miocardi es va valorar a les 1, 4 i 6 setmanes després de la CI. ( c - e ) Anàlisis citofluorimètriques de mostres de sang recol·lectades 1 setmana abans de la CI i cada setmana fins que els ratolins van morir tacats per marcadors superficials GR-1 i CD11b. Traça representativa de tinció de GR-1 i CD11b de sang recollida de ratolins c-Kit + / + i c-Kit TgD814Y 7 dies abans (panells superiors) i 30 dies després (panells inferiors) CI. ( c ) Corbes que representen els valors mitjans de CD11b + GR-1 + ( d ) i CD11b + GR-1 - ( e ) cèl·lules sanguínies ( n = 8 ratolins per a cada grup). Es reporten dades ± S'informa de SE respecte al primer mostreig de sang per c-Kit + / + i c-Kit TgD814Y , # P <0.05. Es registra un significat entre les mostres de sang c-Kit + / + i c-Kit TgD814Y en diferents moments, * P <0.05 ** P <0.01. ( f ) Masson representatiu de les seccions miocàdiques tenyides de tricromic de pesos i ratolins transgènics 1 mes després de la lesió del miocardi. Teixit blau, fibròtic i miocardi viable i vermell. Barres d'escala 1mm. ( g ) Histograma que mostra el percentatge d'àrea fibròtica en ratolins en pes i transgènics ( n = 7 i n = 9 per a ratolins c-Kit + / + i c-Kit TgD814Y , respectivament) 1 mes després de la CI. Les àrees es mesuren mitjançant el programari ImageJ. Les dades es reporten ± SE ** P <0, 01

Imatge a mida completa

Tal com es mostra a la figura 4a, el 43% dels ratolins c-Kit + / + van morir als 5 dies posteriors a la lesió, mentre que els ratolins c-Kit TgD814Y c-Kit + / + eren resistents a la insulta, ja que cap ratolí va morir després de la cirurgia. Aquest resultat indica que els ratolins transgènics estaven protegits del dany agut. Les mostres de sang es van recollir una setmana abans de lesions cardíaques i 1, 2 i 4 setmanes després del dany per controlar el nivell de cèl·lules inflamatòries circulants. Les quantitats relatives de CD11b + Gr1 + i CD11b + Gr1 - cèl·lules mieloides es van analitzar mitjançant citometria de flux (figures 4b – e). Aquests dos subconjunts de cèl·lules mieloides s’han considerat com a indicadors de la inflamació i la remodelació dels teixits, respectivament. 33, 34 Les figures 4c – e mostren un augment de cèl·lules CD11b + Gr1 + proinflamatòries tant en ratolins com en ratolins transgènics una setmana després del dany. Al cap de dues setmanes, el percentatge de cèl·lules CD11b + Gr1 + va disminuir fins al valor inicial detectat abans del dany en els ratolins transgènics, mentre que el seu percentatge es va mantenir alt en els ratolins en pes (figures 4c i d). CD11b + Gr1 : el percentatge de cèl·lules va caure immediatament després de la CI en els dos tipus d’animals tractats, però només en els ratolins transgènics va tornar al nivell basal en dues setmanes (Figures 4c i e). Aquestes dades demostren que les cèl·lules CD11b + Gr1 + i CD11b + Gr1 són modulades de manera diferent en els ratolins transgènics en comparació amb els animals amb pèrdues posteriors a lesions cardíaques. Aquestes dades també suggereixen que el percentatge relatiu de CD11b + Gr1 + i CD11b + Gr1 en circulació - paral·lelament a la sang, l'augment de la supervivència dels ratolins transgènics en comparació amb el pes.

Per avaluar directament el dany determinat per la CI, l’extensió de l’àrea fibròtica es va mesurar mitjançant una tinció tricromica Masson 3, 9 i 30 dies després del dany (figures 4f i g i figures suplementàries 3A i B). Tot i que 3 dies després del dany no es va observar cap teixit fibròtic (dades no mostrades), 9 dies després del dany es va trobar una àrea miocàrdica de color massiu tacat de tricromia tant en ratolins pesats com en transgènics (Figs suplementaris 3A i B). En aquest moment, es va trobar un nivell similar d'apoptosi de la paret cel·lular ventricular tant en ratolins en pes com en transgènics (figura suplementària figura 3C). Tot i això, 30 dies després del dany, l’àrea fibròtica era tres vegades més petita en els ratolins transgènics en comparació amb els animals en pes (12, 83 ± 4% enfront del 4, 39% ± 2, 44%) (figures 4f i g i figura suplementària 3D). Paral·lelament, als 30 dies després del dany, la mida de cardiomiocits a la zona fronterera de ratolins transgènics era menor si es compara amb els ratolins de tipus salvatge (figura suplementària figura 3E).

Aquests resultats suggereixen que els ratolins que porten un receptor c-Kit activat de manera constitutiva tenen un avantatge tant en la resposta aguda a la lesió del miocardi com es demostra per una major supervivència, com a llarg termini, com es mostra en una reparació més eficient del teixit necrotic.

L’expressió del receptor c-Kit activat millora la regeneració endotelial i cardiomiòcit després de lesions in vivo

Per tal d'aclarir el mecanisme cel·lular mitjançant el qual l'expressió transgènica promou la reparació cardíaca, es va investigar el creixement i la diferenciació de cèl·lules que expressen c-Kit TgD814Y després de la CI. Es va realitzar una anàlisi d’immunofluorescència per identificar cèl·lules c-Kit + cardíaques internes a la zona lesionada 9 dies després de la lesió (Figura 5a). En aquest moment, el nombre de cèl·lules c-Kit + que mostraven una forma allargada evident, era més elevat en els ratolins transgènics en comparació amb els ratolins pessics (figura 5b; 72 ± 9 cel·les / mm 2 i 55 ± 7 cèl·lules / mm 2 ). Per verificar la taxa de compromís del llinatge vascular de cèl·lules c-Kit + totals, es va valorar l'expressió de c-Kit juntament amb els marcadors de llinatge d'actina muscular endotelial (CD31) i α- fluïdesa dins de la zona danyada. Les cèl·lules c-Kit + eren pràcticament negatives per a l’actina muscular llisa en ambdós genotips, mentre que més del 90% de les cèl·lules c-Kit + co-tacades amb CD31 en els ratolins C-Kit TgD814Y en comparació amb el 60% en els ratolins en pes (figures 5c i d). Paral·lelament, als 30 dies després de la CI, es va observar una densitat capil·lar més gran en els ratolins transgènics en comparació amb els ratolins en zones peri-danyades (figura 5e). Finalment, es van implantar ratolins transgènics i mins amb bombes mini-osmòtiques per alliberar sistemàticament BrdU immediatament després de lesions durant 28 dies, per tal de seguir la regeneració cel·lular del miocardi. Es va observar un triple triple de cardiomiòcits BrdU + de recent formació mono-nucleada en els cors transgènics quan es va comparar amb els ratolins pesats a 1 mes després de la necrosi del miocardi per CI (Figura 5f). En conjunt, aquestes dades suggereixen que, in vivo , l’activació constitutiva del receptor del c-Kit a les cèl·lules del miocardi afavoreix la reparació cardíaca augmentant la resposta angiogènica i miogènica a la lesió.

Image

L'activació de c-Kit indueix una diferenciació endotelial i cardíaca en els cors c-Kit TgD814Y . ( a ) Immunofluorescència de c-Kit (vermell) 9 dies després de la lesió en c-Kit TgD814Y i c-Kit + / + seccions del cor. Barra d’escala 30 μ m. ( b ) Histograma de cèl·lules c-Kit + (es van analitzar n = 3 seccions per a 3 ratolins diferents). Es reporten dades ± SE ( c ) Immunofluorescència per a c-Kit (vermell), CD31, actina muscular llisa (verda) en c-Kit TgD814Y i c-Kit + / + seccions del cor de 9 dies després de la CI. L’asterisme indica c-Kit cèl·lules simples positives. Barres d’escala 30 μ m. ( d ) Histograma de cèl·lules c-Kit + i CD31 + dins de la zona danyada (s'analitzen n = 3 seccions per a 3 ratolins diferents). Les dades es reporten ± SE ** P <0, 01. ( e ) Imatge representativa del ventricle dret c-Kit TgD814Y 30 dies després de la CI, tacada amb IB-4 (de color verd). El gràfic de barres d’histogrames representa el canvi de plec de cèl·lules IB-4 + trobades a l’àrea peri-danyada (es van analitzar n = 2 seccions per a 3 ratolins diferents). Barra d’escala 20 μ m. Les dades es reporten ± SD * P <0, 05. ( f ) Imatge representativa del ventricle dret del c-Kit TgD814Y 30 dies després de la incorporació del CI i del BrdU cardíacs. Inset mostra cardiomiòcit mono-nucleat α -actinina + / BrdU + / WGA + . Barra d’escala 50 μ m. Es reporta un percentatge de BrdU que incorporen cardiomiocits a l'histograma (es van analitzar n = 3 seccions per a cinc ratolins diferents). Les dades es reporten ± SD * P <0, 05

Imatge a mida completa

L’activació del receptor c-Kit augmenta l’activació i la diferenciació de CSC in vitro

Les dades mostrades anteriorment no poden establir inequívocament una relació de producte cel·lular precursor a diferència directa entre cèl·lules c-Kit + comesos i la major formació de cèl·lules endotelials i cardiomiòcits en ratolins transgènics després de lesions. Així, per provar directament aquesta hipòtesi, vam aïllar CD45 - c-Kit + CSCs 35 dels ratolins transgènics i transgènics c-Kit TgD814Y adults (Figura 6a). Quan es va placar en un medi CSC condicionat amb LIF, les cèl·lules transgèniques c-Kit TgD814Y van mostrar un creixement cel·lular augmentat en comparació amb CSC wt, com ho demostren la seva corba cinètica de creixement i la taxa d’incorporació de BrdU in vitro (figures 6b i c). Aquest potencial de creixement més alt es va correlacionar amb un augment del potencial clonogènic establert per deposició unicel·lular (figura 6d). A més, l’activació constitutiva del receptor c-Kit va promoure la formació d’esfera CSC, un marcador in vitro de cèl·lules multipotents, en comparació amb CSC wt (figura 6e). Aquestes característiques cel·lulars dels CSCs de c-Kit TgD814Y es van associar amb l'activació del receptor c-Kit, tal com es demostra amb una fosforilació ERK1 / 2 i AKT augmentada en CSCs transgènics enfront dels CSC (figura 6f). De fet, la inhibició de l’AKT per MK2206, un conegut inhibidor al·lostèric selectiu de l’AKT, i la inhibició d’ERK1 / 2 per PD98059, una molècula petita dirigida selectivament a ERK1 / 2, van ser capaços de reduir la clonogènesi i la velocitat d’ esferogènesi en CSCs cg -Kit transgènics TgD814Y (figures 6g i h).

Image

Els CSC estan activats per c-Kit TgD814Y . ( a ) Citometria de flux de CSCs aïllats dels cors c-Kit + / + i c-Kit TgD814Y . ( b i c ) Corba de creixement cel·lular i avaluació de la incorporació de BrdU de CSCs c-Kit + / + i c-Kit TgD814Y . Les dades es reporten ± SD * P <0, 05. ( d i e ) Es va realitzar un assaig de formació de clons i esferes en CSCs c-Kit + / + i c-Kit TgD814Y i els resultats es resumeixen a la barra d'histograma. Es mostra la imatge representativa dels clons. Les dades es reporten ± SD * P <0, 05. ( f ) Anàlisi WB i densitomètrica sobre extractes de proteïnes de c-Kit TgD814Y i c-Kit + / + CSC de tres experiments diferents. ( g i h ) Es va realitzar un assaig de formació de clons i esferes en CSCs de c-Kit TgD814Y després de 14 dies de tractament amb AKT (MK2206, 1 μ M), inhibidor d’ERK (PD98059, 100 μ M) o la seva combinació. Les dades es reporten ± SD * P <0, 05 versus mostra no tractada (NT)

Imatge a mida completa

Quan es van imprimir cèl·lules en una condició cardiomiogènica de sèrum baix (2%) privada de LIF, els CSC dels ratolins c-Kit TgD814Y mostren una especificació miogènica més gran en comparació amb els CSC wt. De fet, es va detectar un nombre augmentat de transcripcions d'ARNm per a Nkx2.5, conegut factor de transcripció de cardiomiocits i per a Myh7, Actc1 i Tnn3, principals gens contràctils en c-Kit TgD814Y en comparació amb CSC wt (Figura 7a). Tant el tractament amb MK2206 com el PD98059 van afectar significativament la viabilitat de les cèl·lules en condicions de diferenciació miogènica de sèrum baix, impedint l’especificació miogènica amb una regulació negligible de la transcripció cardíaca anterior i els ARNm de gens contràctils (dades no mostrades).

Image

Diferenciació endotelial millorada de CSCs c-Kit TgD814Y . ( a ) qRT-PCR en c-Kit TgD814Y i c-Kit + / + CSCs per a un marcador cardíac després de canviar les cèl·lules en un medi diferenciador de cardiomiòcits. Les dades s’expressen com un augment del doble respecte a la base. Les dades es reporten ± SD * P <0, 05 vers basal i # P <0, 05 vers c-Kit + / + . ( b ) Quantificació semiquantitativa RT-PCR de marcadors endotelials 3 i 10 dies després de canviar c-Kit TgD814Y i c-Kit + / + CSCs a medi endotelial. Els resultats s’expressen com un augment del doble sobre GAPDH ± SD * P <0, 05, ** P <0, 01 i *** P <0, 001. ( c ) La diferenciació endotelial es va inhibir amb tractament de 72 h amb inhibidor ERK1 / 2 (U0, 10 μ M) però no amb inhibidor AKT (LY, 10 μ M). Les dades es registren com a canvi de plec de mRNA ± SD vers NT, * P <0.05, ** P <0.01

Imatge a mida completa

D’altra banda, quan es van encaixar els CSC en un medi de diferenciació endotelial privat privat de LIF, es va observar un augment significatiu de transcripcions d’ARN endotelials CD31 i VEGFR2 en c-Kit TgD814Y en comparació amb c-Kit + / + CSCs ja als 3 dies de diferenciació mitjà, que va ser seguit als deu dies per un nombre més gran de cèl·lules diferenciades endotelials CD31 + (figura 7b i figura suplementària 4A). Curiosament, la diferenciació endotelial va ser abrogada per incubació amb inhibidor de MAPK (UO), però no amb inhibidor AKT (LY) (figura 7c i figura suplementària 4B), cosa que suggereix que el MAPK és necessari per a la diferenciació del llinatge endotelial estimulat per c-Kit.

En conjunt, aquestes dades mostren que, in vitro , l'activació constitutiva del receptor de c-Kit exerceix diversos efectes beneficiosos sobre els CSC millorant la seva amplificació, quan es prolonga per a proliferar, i promovent el seu cardiomiocit i la seva diferenciació endotelial, quan s'ajusta al compromís específic de cèl·lules cardíaques.

Discussió

En el present estudi, es va generar un nou model de ratolí que expressava el receptor de c-Kit amb una substitució d'aminoàcids activant per estudiar l'expressió i l'activació del receptor en el desenvolupament cardíac i el seu paper durant els processos regeneratius. Els ratolins transgènics es van generar mutant un vector BAC que contenia seqüències reguladores endògenes de 67 Kb amunt del codó inicial i 58 Kb aigües avall del codó stop. Com s'ha descrit anteriorment per a altres ratolins transgènics generats amb vectors que abasten regions similars del locus c-Kit , no es va detectar expressió transgènica 27, 36 en el fetge fetal i la medul·la òssia adulta, probablement per la manca de regions potenciadores en la seqüència reguladora de la BAC, 27, però la seva expressió i activació es va augmentar fins a doblar en comparació amb el pes al cor que no sigui el cerebel i els testicles. D’aquesta manera, es va poder estudiar per primera vegada l’activitat del receptor expressada fisiològicament en el teixit cardíac i esclarir les troballes controvertides reportades sobre la contribució putativa de medul·la òssima contra cèl·lules c-Kit + residents residents en la reparació del cor. 18, 22, 23, 37

Les cèl·lules c-Kit + de tipus salvatge responen al lligament del c-Kit c-Kit augmentant la fosforilació ERK1 / 2 i AKT. 38, 39 Hem trobat interessantment un augment constant dels nivells de fosforilació ERK1 / 2 i AKT als cors i a les preparacions de cèl·lules cardíaques aïllades obtingudes a diferents edats de ratolins transgènics. Aquest nivell d’activació, específic per a la mutació del gen activador i confirmat per l’anàlisi de proteïnes de ratolins c-Kit TgWT , no es va estimular més mitjançant el tractament de les cèl·lules amb el lligament c-Kit específic.

En conjunt, aquests resultats donen suport i confirmen fermament que ERK1 / 2 i AKT es troben entre els principals objectius del receptor de c-Kit en cèl·lules c-Kit + cardíaques. De fet, la substitució de l’àcid aspartic 814 per la tirosina va ser capaç de recapitular l’activació de les vies PI3K i MAPK que es produeixen de manera natural després de l’estimulació KL del receptor wt, permetent així investigar el paper fisiològic del receptor c-Kit al cor. El 814 La mutació aspartica es va trobar prèviament en diferents tipus de tumors i es va induir que induïa una activació constitutiva de c-Kit. 24, 25, 26 En particular, els ratolins transgènics portadors de la mutació c-Kit TgD814Y van ser controlats durant més de 2 anys i no es van detectar tumors com GIST, seminoma o mastocitosi.

La WB i la immunohistoquímica es va realitzar en una caracterització completa de l’expressió c-Kit TgD814Y al cor que va demostrar que el receptor activat s’expressa durant l’embriogènesi, la vida neonatal i l’adulta. Els vectors BAC, conservant la regulació gènica endògena, van donar l’oportunitat d’estudiar cèl·lules c-Kit + cardíaques pel que fa al seu origen putatiu des del primer camp cardíac, proepicardi o epiteli a la transició mesenquimal. Cal caracteritzar més per comprovar si les dues subpoblacions que expressen nivells baixos i alts de c-Kit, recentment descrites, 40, 41, 42, 43 estan regulades de manera diferent en cors de ratolins c-Kit TgD814Y . En creuar els ratolins c-Kit TgD814Y als ratolins pKit EGFP , vam arribar a la conclusió que el nombre i la localització de c-Kit + EGFP + cèl·lules dobles positives eren similars entre pKit EGFP i c-Kit TgD814Y pKit cors EGFP indicant un comportament similar de wt i transgènic. cèl·lules de l’òrgan intacte. Aquestes observacions suggereixen que l'activació constitutiva de les vies ERK1 / 2 i AKT in vivo no influeix en la proliferació i / o mort de cèl·lules d'aquestes cèl·lules en condicions normals o que aquests esdeveniments es produeixen en una finestra estreta abans que les cèl·lules c-Kit + siguin diferenciades. D’altra banda, els experiments in vitro van mostrar un millor potencial de proliferació i creixement de CSCs c-Kit TgD814Y purificats de ratolins c-Kit TgD814Y adults que indiquen que la mutació del receptor és per si mateixa capaç d’activar plenament el programa de proliferació d’aquestes cèl·lules.

Per provar l’eficàcia del transgene en la regeneració cardíaca, vam aprofitar la tècnica d’IC. Es va escollir 44, 45 CI perquè és capaç d’induir un dany cardíac focal, transmural i reproductible. Els ratolins transgènics eren més resistents a la lesió (Figura 4). Tots els ratolins van sobreviure després de la CI i van mostrar una reparació de teixits cardíacs en un mes després del dany, cosa que suggereix un rol protector pel transgè c-Kit TgD814Y .

A més, es va observar una reducció consistent de la zona fibròtica després de la CI en ratolins transgènics (figura 4f). Nou dies després de la CI, es va augmentar el nombre de cèl·lules c-Kit + a la zona danyada dels ratolins c-Kit TgD814Y en comparació amb els ratolins c-Kit + / + (Figura 5b). Com que s'ha informat que la fosforilació ERK1 / 2 i AKT pot induir migració i / o diferenciació de cèl·lules mare, 17, 39, 46 nostres resultats indiquen que aquests mecanismes també es podrien produir després de la CI en ratolins T - TGD814Y . Aquesta hipòtesi està en línia amb l'observació de nombroses cèl·lules c-Kit + allargades a la zona danyada que expressen el marcador CD31 endotelial i amb la densitat capil·lar més alta que es troba a la zona peri-danyada dels cors transgènics, cosa que permet especular amb l'activació del c-Kit. Es necessita per a la formació d'un nou vas durant les primeres etapes de la reparació del cor. Aquests resultats s’ajusten a les troballes recents que mostren que les cèl·lules c-Kit + aposten per la diferenciació endotelial 42, 47, 48 i, per primera vegada, demostren que l’activació de MAPK però no la via de senyalització AKT és fonamental per a c-Kit- Diferenciació endotelial mediada. D'altra banda, els resultats obtinguts amb la incorporació de BrdU també suggereixen un paper del receptor c-Kit TgD814Y en la regeneració de miòcits, després que les lesions cardíaques afavoreixin la facturació de cardiomiòcits per a la reparació del cor. El destí bi-potent in vivo dels precursors c-Kit TgD814Y per donar suport a la diferenciació endotelial i cardiomiocita es va confirmar in vitro mitjançant la purificació i el cultiu selectiu dels CSCs del c-Kit TgD814Y i demostrant que tant les vies MAPK com AKT són necessàries per al creixement del CSC i les propietats clonogèniques. així com pel seu compromís endotelial i miogènic. En general, aquests resultats posen de manifest el paper crucial de l'activació del receptor de c-Kit en la reparació del cor, amb una implicació diferenciada de vies de senyalització AKT i / o ERK1 / 2 per mediar les funcions del c-Kit tant en cors sans com en ferits.

Materials i mètodes

Generació de ratolins

La generació de ratolins transgènics c-Kit TgD814Y es va obtenir substituint G a T 2468 en el gen c-Kit del BAC murí RP23-309C11 mitjançant una recombinació homòloga com es va descriure anteriorment. 49, 50

The murine BAC RP23-309C11, containing 80 kb of c-Kit genome sequence and 68 kb of sequence upstream and 57 kb of sequence downstream the c-Kit initiation and stop codons, respectively, was engineered substituting the G to T 2468 to generate c-Kit TgD814Y transgenic mice. Electrocompetent DH10B bacteria with the BAC RP23-309C11 were electroporated with 100 bp oligos containing complementary 20 bp mutated regions around the G to T 2468 nucleotide responsible for the switch of aspartic to tyrosine amino acid. Following the first homologous recombination driven by a temperature-inducible mini- λ phage, a second electroporation, was performed using a 100 bp oligos pairs with the G to T 2468 substitution surrounded with endogenous c-Kit sequence to replace the first oligos pairs and leave the single point mutation. Following the second homologous recombination, the mutation was inserted in the BAC RP23-309C11. The G to T 2468 mutation was confirmed by sequencing analysis and the purified BAC was microinjected into the pronuclei of fertilized C57BL/6 eggs by standard methods. Founder lines were identified by RT-PCR analysis using Sp6 For (5′-ATTTAGGTGACACTATAG-3′) and 309 Rev (5′-CTCTTCTTGACAGTTCCTGC-3′) and CM for (5′-TGTTCACCCTTGTTACACCG-3′) and CM Rev (5′-CCACTCATCGCAGTACTGTT-3′) primers designed in between the vector and c-Kit gene and in the chloramphenicol resistance cassette, respectively.

Two transgenic founders lines, Tg7 and Tg8, were maintained by breeding them to C57BL/6 mice. Homozygotes pKit EGFP (gifted by Prof Ottolenghi, 31 ) were crossed with c-Kit TgD814Y c-Kit +/+ to generate c-Kit TgD814Y c-Kit +/+ pKit EGFP mice (referred as c-Kit TgD814Y pKit EGFP ).

Heterozygote c-Kit + /− mice were generated by replacement of the 16 th intron with a PGK-Neo cassette through homologous recombination, resulting in functional inactivation of the gene. A 7 kb BamH1 fragment of the mouse c-Kit gene spanning from intron 14 to intron 17 was utilized to generate by PCR amplification a 1.5 Kb left arm of homology (spanning from intron 14 to exon 16, with an artificial 3′ Xho I site) and a 4.5 Kb right arm of homology (spanning from exon 17 to intron 17, with an artificial 5′ EcoRV site). A Xho I-EcoRV 1.6 Kb PGK-Neo cassette was added upstream to the EcoRV site of the right arm, and a Sal I 3.0 Kb PGK-TK cassette was added to the 3′ Bam H1 site (after partial filling of the Sal I site in the cassette and the Bam H1 site in the right arm). Subsequently, the left arm of homology was added to the Xho I site of the construct. A 11 Kb Not I gene targeting fragment (containing sequentially the left arm of homology, the PGK-Neo cassette, the right arm of homology and the PGK-TK cassette, see Supplementary Figure 1) was electroporated in ES cells, which were subsequently treated with neomycin and gancyclovir for positive and negative selection, respectively. Screening of homologous recombinant ES colonies was performed by Southern blot using a 600 bp EcoRV- Bam H1 external 5′ genomic c-Kit probe and digesting genomic DNA with EcoRV. Positive recombinants were identified by the appearance of a 3 Kb diagnostic band. The identified recombinant ES colonies were injected in mouse blastocysts by standard methods to generate heterozygous mice in which the 1 kb 16th c-Kit intron had been replaced by the 1.6 Kb PGK-Neo cassette. Heterozygote c-Kit +/− mice were crossed with c-Kit TgD814Y c-Kit +/− to generate c-Kit TgD814Y c-Kit +/+ , c-Kit TgD814Y c-Kit +/− or c-Kit TgD814Y c-Kit −/− mice. These mice showed all the typical phenotypic aspects of the White spotting mutation, including lethality in the homozygous condition, are in agreement with previous evidence that the inclusion of a neo gene in intronic sequences severely interferes with the expression of the c-Kit gene. 51

Mice of 1–9 dpp and adults were killed by cervical dislocation. All our investigations conform with the Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes, and were conducted with the approval of the Tor Vergata University's Animal Use for Research Ethic Committee and by the Italian Ministry of Health.

Copy number assay

In order to quantify c-Kit TgD814Y transgene copy number, we performed a real-time PCR assay, based on evaluation of genomic c-Kit sequence from the transgene. Probe and primers were specific for exon 14 of the c-Kit gene.

The c-Kit TgD814Y copy number was determined using TaqMan Copy Number Assays (Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. In brief, genomic DNA (20 ng) was combined with 2 × TaqMan Genotyping Master Mix, TaqMan Copy Number Assay for mouse c-Kit (Mm00161478_cn Cat. # 4400291) and TaqMan Copy Number Reference Assay for mouse Tert in a 20 μ l reaction volume. The assay was performed using the Applied Biosystems I 7500 Fast Real-Time PCR System (Life Technologies, Thermo Fisher Scientific) and the following thermal cycling conditions: 95 °C for 10 min, and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Samples were assayed using triplicate wells for each gene of interest and copy numbers were estimated by relative quantitation normalized to the known copy number of the reference sequence using the comparative Ct (ΔΔCt) method. The Ct data were subsequently compared with a calibrator sample known to have two copies of the target sequence, analyzed by Applied Biosystems CopyCaller Software (v.2.0; Applied Biosystems) according to the product instruction. Each analysis was carried out with three mice tail DNA of c-Kit +/+ and c-Kit TgD814Y c-Kit +/+ mice. The analysis indicates that transgenic mice integrated one copy of BAC RP23-309C11 construct in genomic DNA. *** P 80% and ΔCq standard deviation between replicates was <0.20.

Newborn cardiac cells isolation, stimulation and immunofluorescence

Cardiac cells were prepared from ventricles of 1–3 dpp newborn pups and cultured as previously described. 52

Freshly isolated newborn cardiac cells, pretreated or not for 30 min with 5 μ M Imatinib-mesylate (sc-202180, Santa Cruz Biotechnology, Inc., Dallas, TX, USA), were stimulated for 10 min with 100 ng/ml KL (R&D Systems, Inc., Minneapolis, MN, USA) before protein extraction.

Immunofluorescence on newborn neonatal myocytes was performed after 24 h of culture. Cells were fixed with 4% PFA, blocked with PBS/0.5% BSA/3% horse serum and stained overnight at 4 °C with mouse anti-sarcomeric myosin (1:5; MF20, Hybridoma Bank, Iowa, IA, USA); rabbit anti-MEF2C (1:100; Abcam: ab64644, Cambridge, UK) and goat anti-c-Kit (1:100; R&D) and then incubated 1 h at 37 °C with anti-rabbit FITC and anti-goat Cy5 secondary antibodies (1:300; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA). Images were acquired by Nikon Eclipse Ti - S microscope (Nikon Instruments SpA, Firenze, Italy).

Adult CSC purification and differentiation

CSCs were isolated from adult transgenic and wt hearts by enzymatic methods. 35, 40 For CD45 c-Kit + cell purification, myocyte-depleted small cardiac cells were incubated with microbeads conjugated with anti-mouse CD45 antibody (Miltenyi Biotec Srl, Calderara di Reno (BO), Italy) and removed from the preparation by magnetic-activated cell sorting (Miltenyi). From the CD45 fraction, the c-Kit + (CD45 ) cardiac cells were enriched through incubation with a microbeads-conjugated mouse monoclonal antibody against c-Kit (Miltenyi) and separated by magnetic-activated cell sorting.

Freshly isolated CD45 c-Kit + cardiac cells were cultured on gelatin-coated dishes in CSC growth medium 35, 40 before clonogenic, spherogenic and BrdU assays.

Cardiosphere myogenic differentiation was performed as previously described. 35

Endothelial differentiation was obtained by culturing the CSC for 3–10 days in MEM Alpha (Life Technologies), 10% ESQ-FBS (Life Technologies), 1 μ M dexamethasone, 50 μ M/ml ascorbic acid, 10 mM β -glycerophosphate (all from Sigma-Aldrich, Milano, Italy) and 10 ng/ml VEGF (PeproTech EC Ltd., London, UK). LY294002 (10 μ M, Calbiochem, San Diego, CA, USA) and UO126 (10 μ M, Cell Signalling Technology, Danvers, MA, USA) were added to the culture for AKT and ERK1/2 inhibition.

Clonogenic, spherogenic and BrdU assays

To show clonogenicity, single-cell cloning was used through depositing single CD45 c-Kit + cardiac cell into wells of 96-well gelatin-coated Terasaki plates by serial dilution. Individual CD45 c-Kit + cells were grown in mCSFM for 1–3 weeks when clones were identified. 35, 40 The clonogenicity of the CD45 c-Kit + cells was determined by counting the number of wells in each 96-well plate, which contained clones and expressed as a percentage. A total of 10 plates were analyzed for each experiment.

For cardiosphere generation, CD45 c-Kit + CSCs were placed in bacteriological dishes with cardiosphere generation medium (mCSFM) composed of 1:1 ratio of CSC growth medium and Neural Basal Media supplemented with B27 and N2 supplements (Life Tech). Cardiospheres were counted per plate at 14 days and the number expressed as a percentage relative to the number of plated CSCs. 35, 40 For Akt inhibition, MK2206 (Enzo Biochem, New York, NY, USA) was used at a concentration of 1 μ M. For Erk1/2 inhibition, PD98059 (Cell Signaling) was used at a concentration of 100 μ M.

To assess the proliferative activity of c-Kit + CD45 cardiac cells in vitro , 10 μ M bromodeoxyuridine (BrdU, Roche, Monza, Italy) was administered in cell plate for 30 min after 48 h serum-free medium conditions (T0) and every 8 h for 1 day. Then, cells were analyzed by flow cytometry (PE-conjugated Anti-BrdU, eBiosciences, San Diego, CA, USA).

Bone marrow and blood cells isolation

Bone marrow cells were isolated from adult mice by flushing both femurs and tibias with 2 ml of PBS using a 25-gauge needle syringe. Cells were pelleted, washed and re-suspended for the analysis.

For white blood inflammatory and remodeling marker staining, 200 μ l of blood samples were collected from mice eyes in heparin-treated vials then red blood cells were lysated using RBC Lysis Buffer (BioLegend, London, UK) as the protocol.

Anàlisi de citometria de flux

Bone marrow cells were re-suspended in FACS buffer (PBS/2% FBS/2 mM EDTA) and stained for 1 h at 4 °C with rat anti-c-Kit CD117 Alexa Fluor 647 (Invitrogen: RM6221, Thermo Fisher Scientific-Life technologies, Waltham, MA, USA) antibody. Dead cells were stained with 7 Amino-Actinomycin D dye (Sigma Aldrich).

White blood cells were stained in 100 μ l of FACS buffer with rat anti-CD11b PE-Cy7 (Pharmingen: 25-0112, Gurgaon, Haryana, India) and rat anti-GR-1 APC antibodies (Pharmingen: 17-5931) at 4 °C for 1 h. Dead cells were stained with Sytox-Blue dye. Analysis was performed with CyAn cytofluorimeter (Dako, Milano, Italy).

Isolated CSC analysis was performed on FACSCanto II with FlowJo software to identify c-Kit expression by mouse monoclonal APC-conjugated anti-c-Kit antibody (Miltenyi). Appropriate labeled isotype controls were used to define the specific gates.

mRNA extraction and RT-PCR analyses

mRNA was extracted from CSCs with Trizol (Sigma Aldrich) using Qiagen RNAEasy miniKit (Milano, Italy) following the manufacturer's instructions. Traces of genomic DNA were removed before retro-transcription using DNA Free Zymo Research kit. RNA was quantitated using a Nanodrop 2000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and 0.5–1.0 μ g of total RNA was retro-transcribed using SuperScript II transcriptase (Life Technologies/Invitrogen/Thermo Fisher Scientific) according to the manufacturer's instructions using the High Capacity cDNA Kit (Applied Biosystems).

Reverse transcription-qPCR was performed with the TaqMan Primer/Probe sets (specific primers were purchased from Invitrogen and the relative catalog numbers are available upon request) using StepOne Plus Real Time PCR System (Applied Biosystems) following the manufacturer's instruction.

Data were processed by the ΔCt method using StepOne Software v2.3. mRNA was normalized with GAPDH and all reactions were carried out in triplicate.

For semiquantitative RT-PCR, primers were as follows: CD31 forward 5′- CGAAGTTAGAGTTCTCCTCC-3′ and CD31 reverse 5′- TCTGATACTGCGACAAGACC-3′; VEGFR1 forward, 5′-GGTATGACTTCTGCACTGAG-3′ and VEGFR1 reverse 5′- CACCAATGTGCTAACCGTCT-3′; VEGFR2 forward, 5′-GTGTCTCTTTGCGCTAGGTA-3′ and VEGFR2 reverse, 5′-TTGCCTCACAGAAGACCATG-3′;

Isl1 forward, 5′-GCAGCAACCCAACGACAAAA-3′ and Isl1 reverse, 5′-AATTGACCAGTTGCTGAAAAGC-3′; GAPDH forward 5′-GTGAAGGTCGGTGTGAACG-3′; GAPDH reverse 5′- ATTTGATGTTAGTGGGGTCTCG - 3′. RT-PCR products were separated in a 1% agarose gel stained with ethidium bromide.

Immunoprecipitation and WB analyses

Heart tissue, newborn cardiac cells and CSCs were homogenized into RIPA buffer (150 mmol/l NaCl, 50 mmol/l Tris-HCl pH 7.6, 1% NP40, 0.5% Sodium deoxycholate, 0.1% Sodium dodecyl sulfate, 10 mmol/l β -glicerophosphate, 1mmol/l DTT) containing phosphatase and protease inhibitors before WB analysis as described in Supplementary Methods.

For immunoprecipitation analyses, specific antibodies were incubated with a mixture of protein A and/or G-Sepharose beads (Sigma-Aldrich) in lysis buffer containing 0.05% BSA for 60 min under constant shaking at 4 °C. The beads were then washed twice with lysis buffer and incubated for 90 min at 4 °C with clarified cell lysates under constant shaking. Sepharose beads-bound immunocomplexes were rinsed three times with lysis buffer and eluted with Laemmli buffer. Proteins were separated on SDS-PAGE 8% gels and transferred to PVDF membranes (GE Healthcare, Milano, Italy). These were incubated overnight at 4 °C with rabbit anti-c-Kit (1:100) sc-168; mouse anti-pERK1/2 (1:1000) sc-7383; rabbit anti-ERK 2 (1:1000) sc-154; rabbit anti-pAKT1/2/3-ser473 (1:1000) sc-7985; mouse anti-AKT1/2/3 (1:1000) sc-81434; mouse anti-pTyr (1:1000) Millipore 05-321 (Vimodrone (MI), Italy); mouse anti-tubulin (1:2000) Sigma T 5168 all from Santa Cruz Biotechnology and then with the appropriate horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology). The horseradish peroxidase conjugate was detected by chemiluminescence with an ECL Kit (Santa Cruz Biotechnology) and autoradiography. Densitometry was performed using Molecular Dynamics Densitometer and ImageJ software.

Protein lysates obtained from CSCs (~50 μ g) were separated on 10% SDS-polyacrylamide gels. After electrophoresis, proteins were transferred onto nitrocellulose filters, blocked with either 5% dry milk or 5% bovine serum albumin, and incubated with Abs against AKT (#9272), p-AKT (#4058 S), ERK1/2 (#9102) and pERK1/2 (#9101) (all from Cell Signaling) at dilutions suggested by the manufacturers. Proteins were detected by chemiluminescence using horseradish peroxidase-conjugated 2Abs and the Alliance UVITEC Cambridge system (Eppendorf, Milano, Italy).

Heart injury

The CI was performed by a technician blinded to the genotype of mice, essentially as previously reported. 45 Briefly, under general anesthesia with Avertin (Sigma, 250 mg/kg), mice were subjected to surgery. The abdominal cavity was opened and CI was inflicted through the intact diaphragm on the heart pushed toward the probe. Heart damage was performed by applying for 5 sa 5 mm diameter metal probe cooled to −196 °C with liquid nitrogen. The abdominal cavity was closed with sutures. Mice received 500 μ l of glucose solution (5% glucose in physiologic solution) and the analgesic Atradol (3 mg/kg), soon after the surgery. Mice were killed and their hearts harvested 3 ( c-Kit +/+ n =2; c-Kit TgD814Y c-Kit +/+ n =2), 9 ( c-Kit +/+ n =10; c-Kit TgD814Y c-Kit +/+ n =8) and 30 ( c-Kit +/+ n =12 and c-Kit TgD814Y c-Kit +/+ n =13) days after the CI.

A set of mice ( c-Kit +/+ n =10; c-Kit TgD814Y c-Kit +/+ n =10) were treated with BrdU for 30 days. Half of them, for each genotype, was damaged with CI as previously described. BrdU (0.6 M) was administered continuously using Alzet osmotic mini pumps (Charles River Laboratories, CALCO (Lecco), Italy). The latter were implanted subcutaneously in the dorsal region via a small interscapular incision using sterile surgical technique, while the animals were under light avertin anesthesia.

Tissue harvesting, immunofluorescence, immunohistochemistry and TUNEL assay

Hearts were collected at different ages, the atria were removed and the ventricles were placed in Hank's balanced solution (Euroclone, Pero (MI), Italy) squeezing gently to remove the remaining blood from the chambers. After washing in PBS, the ventricles were embedded in OCT (Bio-Optica, Milano, Italy), frozen in isopentane chilled with liquid nitrogen and stored at −80 °C before immunohistochemistry and immunofluorescence analyses as described in Supplementary Methods. In order to preserve GFP, ventricles taken from pKit EGFP mice and c-Kit TgD814Y pKit EGFP mice were pre-fixed in PBS/4% PFA pH 7.4 (Sigma) overnight at 4 °C and then included in OCT. Embryos were directly included in OCT, frozen in isopentane chilled with liquid nitrogen and stored at −80 °C.

For EGFP + cardiac cell count, at least 20 sections of 5 μ m thickness were collected from each heart and analyzed for c-Kit and EGFP staining at different postpartum developmental time for pKit EGFP mice and c-Kit TgD814Y pKit EGFP mice: at 1 day n =4 and n =5 mice, respectively; at 10 days n =4 and n =6 mice, respectively; at 2 months old n = 5 and n =6 mice, respectively. Images were acquired with Zeiss microscope (Axioskop 2 plus, Zeiss, Carl Zeiss Microscopy, Thornwood, NY, USA). EGFP-positive cardiac cells were counted throughout the left and right ventricle for each section. The EGFP-positive cell number was calculated as mean number per section.

Immunofluorescence was performed in 5 μ m-thick sections fixed in PBS/4% PFA for 10 min at room temperature before staining. After permeabilization and blocking with PBS/1% BSA, slices were incubated with primary antibodies diluted in PBS/1% BSA overnight at 4 °C. Undamaged and damaged heart sections were stained with the following primary antibodies: goat anti-c-Kit (R&D) 1:100 and rat anti-CD31 (eBioscience: 14-0311) 1:100; rabbit anti- α -SMA (Abcam: ab5694) 1:100. In order to reveal c-Kit receptor in embryos, sections were stained with goat anti-c-Kit (R&D) diluted 1:50. Secondary antibodies anti-rat Alexa Fluor 488, anti-rabbit FITC and anti-goat Cy5 all from Jackson were diluted 1:300. Nuclei were stained by Hoechst 33342 solution.

To quantify fibrotic tissue, trasversal serial sections of ventricles (5 μ m of thickness) were collected, fixed in Bouin solution (Sigma) and stained with Masson's Trichrome kit (Sigma). Collagen was detected in blue and myocardial cells in red. Images were acquired by Axioskop 2 plus, Zeiss microscope and ImageJ software was used to quantify the fibrotic area. The fibrotic residual area of each collected section was measured in pixels and expressed as percentage respect to total area, without the lumen. The injured size was then calculated as the mean percentage of slices for all ventricles.

Apoptosis was evaluated on three heart sections derived from three different c-Kit +/+ and c-Kit TgD814Y c-Kit +/+ mice 9 days after the CI by following TUNEL assay (Roche) manufacturer's instructions.

BrdU, WGA and IB-4 stainings

Damaged hearts from BrdU-treated mice were perfused with buffered formalin and embedded in paraffin, and 5 μ m-thick sections were cut.

Antigen retrieval was achieved using Target Retrieval Solution, Citrate pH 6 (DAKO). Myocyte cytoplasm was detected using an antibody against α -actinin (1:50 dilution, Clone H-300, Santa Cruz Biotechnology) for 3 h at 37 °C and this was detected with anti-rabbit Alexa Fluor 647 (1:100 dilution; Jackson Immunoresearch Laboratories, Inc., West Grove, PA, USA). BrdU was detected using an antibody against BrdU (1:50 dilution; Roche) for 45 min at 37 °C. This antibody was detected with an anti-mouse Alexa Fluor 488 (1:100 dilution; Jackson Immunoresearch). Newly formed myocytes were detected through double staining for BrdU and α -actinin. Secondary antibody incubation was carried out at 37 °C for 1 h. Wheat germ agglutinin (Alexa Fluor 594 conjugate WGA; Life Technologies) staining was performed for cardiomyocyte dimension analysis. The nuclei were counterstained with the DNA-binding dye, 4, 6-diamidino-2-phenylindole (Sigma) at 1 μ g/ml. Sections were mounted in Vectashield and analyzed and scanned using confocal microscopy (Leica Microsystems TCS SP5, Milano, Italy). ImageJ software was used to quantify the cardiomyocyte area.

For IB-4 staining, 5 μ m heart sections were deparaffinized and treated with 10 mM sodium citrate solution (Santa Cruz Biotechnology), pH 6.0, in microwave for 10 min. After permeabilization with 0.1% PBS-Triton X-100 v/v at RT for 8 min, sections were blocked with PBS-1% BSA w/v for 30 min at RT and capillaries were stained with IB-4 - FITC conjugated (Sigma) overnight at 4 °C. Nuclei were stained with Hoechst 33342. Slides were mounted with glycerol in 50 mM Tris-HCl solution pH 8.7 (1:1). Images were acquired by Nikon Eclipse Ti - S microscope. The number of capillary was counted in 10 images/section and reported as fold change.

Anàlisis estadístiques

Statistical analysis was performed with GraphPad Prism version 6.00 for Macintosh (GraphPad Software, Inc., La Jolla, CA, USA). Quantitative data are reported as mean±SE or mean±SD and binary data by counts. Significance between two groups was determined by Student's t test or paired t test as appropriate. For comparison between multiple groups, ANOVA was used. Es va considerar significatiu un valor P <0, 05. Bonferroni post hoc method was used to locate the differences. In these cases, the type 1 error ( α =0.05) was corrected by the number of statistical comparisons performed. If not specified, a n =4 sample size was used for the in vitro cell and molecular biology experiments. The Kruskal–Wallis (for multiple‐group comparison) and the Mann–Whitney U tests (for comparison between two groups) were performed.

Informació complementària

Fitxers PDF

  1. 1.

    Informació complementària

Glossari

CI

cryoinjury

CSCs

cardiac stem cells

IB-4

isolectin B4

KL

c-Kit ligand

La informació complementària acompanya aquest treball al lloc web de la mort i la malaltia cel·lular (//www.nature.com/cddis)