Nanohíbrids de baculovirus bioactius per a la re-endotelialització vascular ràpida basada en stent | informes científics

Nanohíbrids de baculovirus bioactius per a la re-endotelialització vascular ràpida basada en stent | informes científics

Anonim

Temes

  • Enginyeria Biomèdica
  • Materials biomèdics
  • Enginyeria de teixits
  • Enginyeria de teixits i medicina regenerativa

Resum

El present estudi, per primera vegada, informa del desenvolupament d’un stent basat en baculovirus nanohidratat que pot afavorir localment la re-endotelialització vascular mitjançant el lliurament eficient de gens de factor de creixement endotelial pro-angiogènic (creixement Vegas). Les dades in vitro van demostrar una ràpida expressió de Vegf funcionalment actiu per part de les cèl·lules vasculars transduïdes per stent bioactives. Es va observar in vivo una expressió transgènica específica del lloc a les regions estentades de l’artèria femoral canina denudada per globus aerostàtics, que acabaria provocant una recuperació endotelial significativa als llocs lesionats. Es va observar una reducció significativa de la formació de neointima (2, 23 ± 0, 56 mm 2 contra 2, 78 ± 0, 49 mm 2 i 3, 11 ± 0, 23 mm 2, p <0, 05; n = 8) i percentatge d'estenosi en el grup de stent tractat en comparació amb el control negatiu i el stent de metall nu. grups. Aquestes troballes impliquen col·lectivament el potencial d’aquest nou stent bioteràpic basat en baculovirus per millorar la biologia vascular danyada i atenuar el restringiment de l’artèria stentada inhibint la formació de neointima.

Introducció

L'angioplàstia coronària percutània i el stenting és un dels procediments d'intervenció més utilitzats per al tractament de malalties de l'artèria coronària 1 . Una complicació freqüent a llarg termini d’aquest tractament és el fenomen de la restenosi in-stent (ISR) que es produeix al lloc de la lesió ateroscleròtica, provocant l’obstrucció de les artèries marcades. El disseny de material bioterapèutic avançat recobert stents intravasculars per promoure la re-endotelialització d’artèries amb stent deteriorades pot oferir una teràpia alternativa prometedora a l’elution de medicaments àmpliament utilitzats (DES) i a stents de metalls nu 2, 3, 4, 5, 6, 7, 8 . Les DES i els stents metàl·lics estan actualment limitats per una recuperació endotelial incompleta a causa de fàrmacs antiproliferatius, efectes secundaris inadvertits 9, 10, 11 i augment del risc de trombosi de stent tardà 12 . Estudis recents han demostrat la importància d’aquests nano-biomaterials per desenvolupar nous bioteràpics que tinguin les característiques úniques per restaurar la biologia vascular natural promovent la curació natural al contrari del DES 13, 14, 15, 16, 17, 18, 19 . Aquestes tecnologies tenen el potencial únic de promoure un lliurament localitzat i sostingut de biomolècules, com els gens terapèutics, a la paret arterial danyada utilitzant la superfície de stent com a estructura i bastidor permanent per a un lliurament prolongat de gens arterials 20, 21, 22 . A més, l’atrapament de baculovirus recombinant a la superfície de stent permet augmentar la concentració local d’agent terapèutic en el segment arterial objectiu sense que s’estengui distal cap a teixit no objectiu, evitant així la toxicitat sistèmica i augmentant la possibilitat d’una transfecció genètica efectiva a cèl·lules adjacents.

El present estudi, per primera vegada, introdueix un nou enfocament on es van utilitzar materials nanohíbrids recombinants específics de cèl·lules insectes i específics de les cèl·lules d’insectes per a l’administració de gen basada en stent per afavorir la re-endotelialització vascular de l’artèria lesionada ( figura S1 ). La superfície vírica s’ha modificat químicament per formar nanoestructures catiòniques, similars als nostres estudis anteriors 23, 24, 25, per a l’entrega local de gens terapèutics del factor de creixement endotelial vascular humà-A 165 (Vegf) per atenuar ISR 26 . El baculovirus específic de la cèl·lula d’insectes (Bac) ofereix un avantatge únic respecte d’altres sistemes d’administració de gens a causa de la seva capacitat de transduir eficientment cèl·lules no divisòries, incapacitat inherent de replicar-se en cèl·lules de mamífers, baixa citotoxicitat fins i tot a dosis virals elevades, absència d’anticossos preexistents contra Bac en animals i també escala de producció fàcil fins a un elevat títol viral 27, 28 . Per contra, els virus de mamífers àmpliament experimentats han demostrat riscos elevats d’invocar respostes inflamatòries i la probabilitat d’integració aleatòria al genoma del mamífer hoste que condueix a un perfil de seguretat clínica insuficient 29 . Mentre que, tal com s’ha documentat en el nostre estudi anterior, el bac recombinant pot ser un vector ideal per a aplicacions temporals de teràpia gènica com la curació de ferides i la recuperació endotelial on l’expressió gènica cessa un cop finalitzada la seva tasca 24 . Tot i això, els baculovirus no tenen una eficiència de transducció elevada en comparació amb els vectors mamífers 30 . Així, han estat intenses investigacions sobre modificacions genètiques i superficials de Bac per millorar la seva capacitat d’unir-se a la superfície cel·lular del mamífer i millorar la seva falta d’especificitat, millorant així l’eficiència de la transducció i superant els inconvenients dels baculovirus com a portador de gens 31 .

Aquí, per millorar l’eficàcia de lliurament de gens, hem funcionalitzat la Bac amb superfície de nanopartícules sintètiques cationiques de poliamidoamina dendamer (PAMAM) i hem investigat el seu efecte en la eficiència de la transducció 4 . A més, per protegir-los de la inactivació sèrica i aconseguir un alliberament controlat en el lloc objectiu, els nanohíbrids Bac han estat encapsulats eficientment dins de les microsfores poli (làctic-co-glicòlic) (PLGA) tal com optimitzades en estudis preliminars in vitro ( Figura S2 i Taula S1 ) 32 . Els EM es van impregnar en fibrina hidrogel i es van recobrir utilitzant conjunts capa per capa en la superfície 33 de stent prefabricat, que finalment actua com a bastida per lliurar els nanohíbrids virals protegits al lloc objectiu. Es va postular que aquesta nova generació de dispositius de stent que elueixen genes pot lliurar de manera eficient genes vasculars angiogènics al lloc afectat i induir efectes terapèutics favorables en la biologia vascular local, com es mostra a la figura S1 per promoure la curació de ferides locals. D’acord, l’estudi va valorar la hipòtesi mitjançant la investigació de l’eficàcia del dispositiu stent mitjançant Vegf que portava nanohíbrids recombinant baculovirus (Bac vegf ) i controlar Bac que no tenia gen (Bac Null ), seguit d’avaluar el seu potencial per accelerar la re-endotelialització i atenuar la restenosi in-stent (ISR) en artèria femoral de gos ferit en globus.

Resultats

Fabricació i caracterització de stent bioactiu basat en baculovirus

Per millorar el lliurament de gens, com a primer pas, les partícules anaciques de Bac van ser recobertes superficialment amb dendrimer PAMAM per generar els nanocomplexos catiònics Bac-PAMAM. La formació amb èxit de nanocomplexos Bac-PAMAM es va confirmar mitjançant l'anàlisi del zeta potencial dels nanocomplexos Bac, tal com es va informar a la figura S3a. Les dades mostren que els dendrímers PAMAM carregats positivament, després de la conjugació amb els baculovirus carregats negativament, van formar nanocomplexes que van donar lloc a un augment de la càrrega superficial cap a la positiva. La formació de nanocomplex es va confirmar a més mesurant la mida de les partícules dels nanocomplexos formats ( figura S3b ). La grandària significativa augmentada de les partícules Bac-PAMAM (0, 05), on el valor entre claudàtors representa la concentració de PAMAM en μmol, en comparació amb el Bac lliure, indica la formació eficient de nanocomplexos Bac-PAMAM, generats per fortes interaccions electrostàtiques entre baculovirus i dendrimers PAMAM. La mida excessivament més gran del grup Bac-PAMAM (0, 1) és probablement deguda a la formació d’agregats i grups més grans dels complexos formats. Les imatges de micromòbils d’electrons de transmissió (TEM) de la figura S3c demostren l’enllaç eficient de la vareta com el baculovirus amb dendrímers PAMAM (0, 05) que condueixen a la formació del complex híbrid Bac-PAMAM.

Per encapsular els baculovirus, es va estudiar el mètode de preparació i la font d’energia necessària per a la formació de l’emulsió primària i optimitzar in vitro . Després d'optimitzar (detalls en informació addicional), vam seleccionar el mètode d'evaporació de dissolvents de doble emulsió per preparar les micropartícules bioactives encapsulades del virus 34 . Es va afegir Bac a PLGA dissolt en diclorometan (DCM) i la mescla es va sonicar o homogeneïtzar amb i sense albúmina sèrica bovina (BSA) / glicerol. El dissolvent hidròfob (oli de blat de moro) es va utilitzar en la segona emulsió en un mateix mètode (p / o / o) i en comparació amb el mètode de dissolvent hidrofílic (alcohol polivinílic, PVA) (p / p / p). Es va notar una quantitat significativament més gran d’eficàcia d’encapsulació en el mètode w / o / o que confirma que hi havia menys pèrdues víriques amb l’oli en comparació amb l’aigua en fase continua. Tal com es desprèn de la taula S1 que resumeix l'eficàcia d'encapsulació de virus i els diàmetres de partícules dels mètodes de preparació individual, vam concloure que un procediment d'emulsió aw / o / o doble amb emprat homogenitzador mecànic pot encapsular eficientment els baculovirus, i es pot millorar encara més complementant-los amb BSA. / glicerol per protegir l’activitat viral.

Els stents polimèrics preparats que contenien les microsfores PLGA (pel mètode w / o / o), barrejats amb el colorant vermell del Nil com a traçador, es liofilitzaven i es fotografiaren per confirmar que el stent polimèric era capaç de retenir les microsfores incrustades després de l'expansió de stent. La figura 1a mostra un stent abans i després del recobriment amb capes de fibrina incrustades de MS, mentre que el color rosat del stent confirma la retenció de la EM carregada a la superfície de stent després de l'expansió de stent amb catèter de globus. Una imatge de fluorescència dels stents recoberts de la figura 1b confirma encara més els descobriments anteriors, on es va veure el recobriment de les microsfores a la superfície de stent. Les imatges del microscopi electrònic d’escaneig (SEM) i microscopi de força atòmica (AFM) de la EM a la superfície de stent ( figura 1c i S4a ) van proporcionar més evidències morfològiques sobre les característiques de la superfície dels stents recoberts que demostren els MS PLGA distribuïts incrustats a les puntes de stent multicapa de fibrina. La imatge del microscopi electrònic de transmissió (TEM) de la secció tallada d’un microscopi PLGA carregat per virus demostra la presència de baculovirus a les microsfores que confirma l’èxit de la microencapsulació.

Image

(a) Metalls nus i stent bioactiu amb nanocomplex Bac-PAMAM atrapat a la EM abans i després de segar en un catèter de globus. (b) Imatge de fluorescència del stent que mostra la fluorescent PLGA MS incrustada a la superfície de stent de fibrina. (c) Microfotografia SEM de stents recoberts de fibrina PLGA MS amb més maginificació (a la dreta). La imatge AFM demostra la topografia superficial de les EM, encapsulant els components del baculovirus nanohíbrid. La imatge TEM representa les seccions interiors d'ultratina de la MS que encapsula virus bioactius. (d ) L' eficàcia de lliurament de gens in vitro del stent bioactiu a les cèl·lules vasculars. Les stents experimentals contenen partícules de Bac MGFP, hibridades a molècules de PAMAM de 0, 0, 01, 0, 1, 0, 5 i 1, 0 μmol per 10 8 partícules de baculovirus i incubades en PBS durant 24 hores. En els punts de temps indicats (12 h, 18 h i 24 h) es va recollir PBS incubat i es va utilitzar per a la transducció de HASMC mitjançant el procediment estàndard esmentat a la secció de mètode. Les imatges fluorescents a la dreta representen el GFP que expressa HASMC transduïts de diferents grups, amb el grup bac-PAMAM (0, 5) que mostra la màxima expressió de GFP. Les dades representen la mitjana ± SD (n = 3). Anàlisi ANOVA: * = P <0, 05 i ** = P <0, 01 en comparació entre grups de temps (24 h). # = P <0, 05 en comparació entre grups coincidents de temps (18 h). ψ = P <0, 05 en comparació entre grups coincidents entre temps (12 h).

Imatge a mida completa

Estudis preclínics han confirmat la seguretat de l’ús d’hidrogels, com la fibrina, per recobrir dispositius bombats 35, 36 . Tot i que no posseeix les propietats mecàniques ideals i les característiques de biodegradació necessàries per a un recobriment adequat de stent, la fibrina ha estat considerada com una de les més segures biomaterials per a enginyeria de teixits i aplicacions mèdiques. Amb aquest coneixement, aquí volíem desenvolupar una superfície de stent biocompatible recobrint el stent metàl·lic amb capes d’hidrogel de fibrina optimitzada, impregnat amb PLGA MS biodegradable carregat de baculovirus. La capa més elevada de genipina / fibrina serveix com a barrera als danys externs durant la retolació en el catèter de globus, a més de protegir les capes interiors de l’alliberació precoç de virus durant el seu pas pel lumen de l’artèria en el moment d’implantació al lloc desitjat. L’addició de genipina, com a enllaç natural a la fibrina, també funciona per reduir la possibilitat de reaccions inflamatòries 37 . Mitjançant el mètode de recobriment de stent presentat aquí, la superfície interior del stent (és a dir, la superfície de contacte del mandril) no es va recobrir amb el polímer. En conseqüència, no hi va haver cap recubriment de fibrina al costat del contacte amb la sang del stent. D’aquesta manera vam intentar reduir la pèrdua de virus carregats al flux sanguini.

Per determinar la cinètica d’alliberament dels baculovirus incapsulats de la superfície de stent i modular el seu comportament d’alliberament, es van utilitzar dues concentracions diferents de PLGA (50 i 100 mg / ml de diclorometan, DCM) mitjançant el mètode d’emulsió w / o / o i comparat amb l’estàndard w / o / w mètode. En ambdós mètodes, el grup de stent amb EM preparat a partir de menor concentració de PLGA va mostrar un percentatge molt més ràpid i més gran d’alliberament viral amb el temps en comparació amb la concentració més elevada ( Figura S4b ). A més, el grup w / o / o va mostrar un alliberament significatiu de virus actius a menor concentració de PLGA que el grup w / o / w, després de 24 hores després de la incubació en solució salina tamponada amb fosfat (PBS). Una nova disminució de la concentració de PLGA va provocar formacions de MS no uniformes i, per tant, ens vam limitar a 50 mg / ml de protocol de formulació MS DCGA PLGA MS mitjançant mètode w / o / o per a estudis posteriors.

Per investigar si el MGFP Bac alliberat, baculovirus recombinant que porta el gen reporter Monster Green Fluorescent Protein (MGFP), eren bioactius i poden transduir les cèl·lules musculars llises aòrtiques humanes (HASMC), es van recollir els tampons d’incubació de diferents punts de temps d’alliberament, es van diluir en el mateix. proporcions i afegit a HASMC per a la transducció. Després de 72 h, es van quantificar les expressions de MGFP en termes de percentatge de cèl·lules transduïdes. Per a l'estudi, es van preparar quatre formulacions de baculovirus diferents amb concentracions variades de dendrímers PAMAM abans d'encapsular-les i carregar-les a la superfície de stent. Les dades de la figura 1d – e demostren que la funcionalització de dendrimer PAMAM té un efecte positiu en la transducció mediada per baculovirus amb Bac MGFP -PAMAM (0, 5) mostrant una eficiència de transducció constantment més elevada que altres grups, inclòs el control gratuït de Bac MGFP (control). L'augment de la concentració de PAMAM a Bac MGFP -PAMAM (1.0) però no va mostrar cap millora significativa. D'altra banda, el percentatge de transducció va ser proporcional a l'hora del tampó d'incubació. Això es deu a la major quantitat de baculovirus alliberat al tampó d’incubació amb un temps d’incubació més elevat, tot i que no hi va haver diferències significatives en les eficiències de transducció entre les 18 h i les 24 h en tots els grups. Això indica que els virus actius van ser alliberats majoritàriament entre 12 h i 18 h del stent. A més, els estudis de citotoxicitat de 72 hores sobre l'efecte d'aquestes diferents formulacions sobre HASMC demostren que Bac MGFP -PAMAM es pot utilitzar de forma segura per a la transducció cel·lular, tot i que el grup Bac MGFP -PAMAM (1.0) amb alta concentració de PAMAM va mostrar una citotoxicitat significativament alta respecte al control. Bac lliure i altres grups experimentals ( Figura S5 ).

És important destacar que el grup de stent amb Bac-PAMAM microencapsulat també va mostrar una protecció significativament més elevada de baculovirus bioactius contra la inactivació sèrica en comparació amb els stents amb Bac microencapsulats i els stents de Bac i Bac-PAMAM no encapsulats. Les nostres dades confirmen que fins i tot el recobriment PAMAM també pot protegir el Bac contra la inactivació sèrica fins a cert punt, cosa que es millora encara més incapsulant-les dins de les microsfores PLGA (Figura S6a). A més, la preservació de la bioactivitat del stent durant almenys 3 mesos emmagatzemats a -80 ° C, tal com es mostra a la figura S6b, pot suposar avantatges logístiques importants en situacions clíniques de la vida real, ja que el stent emmagatzemat pot ser immediatament fora de la terra. ús de la prestatgeria per a qualsevol pacient sotmès a angioplàstia i stent sense demora.

Biofuncionalitat in vitro del stent bioactiu desenvolupat

Per estudiar la funcionalitat de les proteïnes Vegf, expressada pel HASMC tractat, es van realitzar diferents assajos de funcionalitat utilitzant en el medi condicionat (CM) en cèl·lules endotelials de venes umbiliques humanes (HUVEC) que tenen una resposta mitòtica i quimiotactica elevada a Vegf. Així, es van recopilar CM a partir de HASMCs de transdució de Bac Vegf -PAMAM (0.5) i Bac Vegf a intervals regulars i es van utilitzar per quantificar el perfil d’alliberament de Vegf mitjançant l’anàlisi ELISA de Vegf. La CM de cèl·lules no transduïdes es va prendre com a control negatiu. Les dades, tal com es mostra a la figura 2a, demostren expressions ràpides de hVegf en grups de Veg Veg: Bac Vegf -PAMAM i Bac Vegf en els primers 4 dies, que van disminuir progressivament durant la setmana. Tot i que l'expressió de Vegf va disminuir considerablement en el grup de Bac Vegf després de tres setmanes, el grup Bac Vegf -PAMAM va mantenir una expressió Vegf significativament més alta. Les bioactivitats del Vegf alliberat en medis procedents del transducte HASMC de Bac Vegf -PAMAM (0, 5) es van avaluar in vitro mitjançant l’observació de la capacitat proliferativa de l’HUVEC. El test de proliferació cel·lular es va utilitzar per avaluar les capacitats de proliferació de l’HUVEC tractat amb CM (que contenia Vegf secretat) a partir d’exemplars experimentals, recollits el dia 4 després de la transducció. Tal com es mostra a la figura 2b, els grups Bac Vegf i Bac Vegf -PAMAM van mostrar una proliferació significativament elevada de HUVEC el dia 3 en comparació amb el control no estimulat, i el Bac Vegf -PAMAM presentava la major proliferació (cèl·lules 3, 98 ± 0, 19 × 10 4 ). Com era d'esperar, el grup tractat amb anticossos contra Vegf no va mostrar efectes proliferatius que demostressin que va ser a causa de la bioactivitat del Vegf alliberat de SMC modificats genèticament que van contribuir a les proliferacions dràstiques de l'HUVEC. Aquesta taxa de proliferació depenia directament de la quantitat de Vegf alliberada, que explica per què Bac Vegf -PAMAM va demostrar millors resultats que Bac Vegf i grups de control no estimulats.

Image

(a) Quantificació de Vegf alliberat de HASMCs transduïts per stent bioactiu al llarg de tres setmanes. (b) Proliferació de HUVEC cultivats en presència de CM procedents de Bac Vegf -PAMAM (amb o sense Ab) i HASMC transduïts de Bac Vegf. Com a grup de control, es va prendre CM des de cèl·lules no transduïdes (Ctrl). La densitat inicial de sembra va ser de 2 × 10 4 cèl·lules per pou en la placa de 96 pous i es va detectar la proliferació cel·lular mitjançant un assaig colorimètric el dia3. (c) Inducció de la migració per HUVEC en un assaig de curació de ferides. La monocapa de cèl·lules HUVEC es va ferir amb rascador de cèl·lules i es va tractar amb CM dels grups esmentats anteriorment. Es van fotografiar HUVEC (200 ×) després del tractament 24 h (d) i es va analitzar el percentatge d’àrea rascada (marcada per la línia de punts blancs) coberta per les cèl·lules migrades mitjançant el software Image J. (e i f) Efecte de la CM dels grups esmentats anteriorment sobre la formació tubular in vitro . Després de 18 hores de co-cultiu amb HUVEC, es va avaluar la formació tubular. Els gràfics representen la longitud relativa del túbul en μm prenent Bac Vegf com a 100% (e) i comptant el nombre de tàbul capil·lar (f). Les dades representen la mitjana ± SD de tres experiments independents. (g) Es va observar una estructura tubular adequada formada en els grups Bac Vegf -PAMAM i Bac Vegf, en comparació amb el control no estimulat i el grup tractat Ab, tal com es va examinar mitjançant un microscopi fluorescent amb una ampliació de 100 ×. ANOVA: Valors significativament més alts dels grups en comparació amb el control es denoten per *** = P <0, 001 i ** = P <0, 01.

Imatge a mida completa

Es van observar resultats similars en el test de curació de ferides on es van mesurar les habilitats de la CM de diferents grups experimentals, recollides el dia 4 després de la transducció, per promoure les migracions de HUVEC. Tal com es mostra a la figura 2c-d, l'estimulació de la monocapa HUVEC ferida amb CM de Bac Vegf -PAMAM va mostrar una curació important de la zona de les ferides (89, 4 ± 7, 5%) en comparació amb la CM de control no estimulat (12, 4 ± 2, 4%) i Bac Vegf (61, 7 ± 5, 5%). La pre-incubació de CM amb els anticossos neutralitzants anti-Vegf dificultava completament la cicatrització de ferides induïda per Bac Vegf -PAMAM CM, cosa que suggereix clarament que calen senyals quimiotàctics de Vegf per a un efecte curatiu adequat de les ferides.

A més, les activitats biològiques de la CM també es van avaluar mitjançant un assaig de formació de tubs HUVEC. Tal com es mostra a la figura 2e-g, les cèl·lules tractades amb CM de Bac Vegf -PAMAM van induir un efecte millorat significativament sobre la formació de la xarxa capil·lar HUVEC en comparació amb les cèl·lules tractades amb CM de Bac Vegf i grups no estimulats. La longitud relativa del túbul es va millorar significativament en el grup Bac Vegf -PAMAM i Bac Vegf en comparació amb el control (141, 5 ± 7, 9 i 100 ± 13, 6 davant 47 ± 2, 1). A més, per avaluar l'extensió de l'impacte de Vegf present en la CM sobre la formació de tubs HUVEC, es va afegir anticorp anti-Vegf al sobrenedant amb CM alliberat. Es va observar una formació de tubs reduïda significativament que proporciona evidències de la forta naturalesa pro-angiogènica del Vegf present a la CM. Resultats similars també es van observar quan es van quantificar els nombres de túbuls capil·lars totals en el grup Bac Vegf -PAMAM i Bac Vegf i es van comparar amb el control no estimulat (15, 5 ± 3, 4 i 10, 1 ± 2, 2 davant 4, 5 ± 0, 7).

Eficàcia in vivo del stent bioactiu a l’artèria femoral canina denudada en globus

El procediment d’implantació de stent in vivo s’ha demostrat a la figura 3a, on els gossos van patir una denudació de l’artèria femoral bilateral per angioplàstia de globus, seguida d’un desplegament de stent al lloc lesionat 29, 38 . Les artèries femorals amb perforació transduïdes amb stent Coated (+) portant Bac vegf -PAMAM, Stent Coated (-) portant Bac Null -PAMAM, i els stents de metalls nus no revestits (control negatiu) es van collir 14 dies després de la col·locació de stent. Després de l'anàlisi RT-PCR, es va poder observar l'expressió del senyal Vegf a totes les seccions proximals, mitjanes i distals de les artèries transduïdes de Bac Vegf -PAMAM [Coated (+)] examinades ( n = 3 stents), mentre que no es va detectar res a Bac Null. -PAMAM [Artèries transduïdes revestides (-)] ( Figura 3b ). Tot i que, el producte RT-PCR de dues setmanes amb mostres de teixit transduït de Bac Vegf va demostrar la presència de la banda de mida adequada per a Vegf a les seccions de l'artèria stentada, no es van detectar bandes a partir de mostres de 16 setmanes que demostressin que l'expressió transgènica és transitòria i desapareix. amb el pas del temps. A més, les seccions d’artèria d’1 cm aproximadament i distals fins a l’artèria stentada no mostraven cap expressió transgènica, cosa que indica que l’administració del gen estava localitzada i restringida a la regió stentada on el virus que conté el puntal recobert de polímer toca la paret interior de l’artèria. El resultat es va confirmar per immunoformació de Vegf expressat a l'artèria stentada. Aquesta expressió transgènica de Vegf mediada en nanohíbrids baculovirus es va localitzar a les zones al voltant dels puntes de stent a les capes íntimes i medials ( figura 3c ), on el polímer del stent toca la superfície arterial; en canvi, no es va observar cap tinció de Vegf a les artèries stentades tractades amb stents Coated (-).

Image

(a) Procediment experimental per a l’experiment in vivo en model caní. L'artèria femoral es va aïllar primer del flux de sang normal mitjançant clips (a. I). La part seleccionada va resultar ferida per catèter de globus aerostàtics (a. Ii). Va ser seguit per la implantació del stent a l’artèria malmesa (a. Iii). (b) Lliurament i expressió de lliurament de transgènics en vegetal. Es va realitzar RT-PCR de teixit extret dels segments de vasos stentats per identificar el gen hVegf. 2 setmanes després de la implantació de stent en grup Coated (+), la transcripció de Vegf continuava present a les porcions proximals (P), mitjana (M) i distal (D) de l'artèria stentada. Però no es va produir cap lliurament de gen a les seccions artèries d'1 cm aproximadament (P ′) i distal (D ′) a la porció estentada. És important destacar que la transcripció també va desaparèixer en grup Coated (+) a la setmana16, confirmant la naturalesa transitòria de l'expressió. (c) Localització immunohistoquímica de Vegf dins de l'artèria femoral estentada en grup Coated (+) a la setmana 2 desplegament de stent. Coated (-) es va prendre com a control. L’expressió Vegf es va produir principalment a la zona de puntes (puntejat blanc) on la superfície de stent tocava el revestiment interior de l’artèria, sense que hi hagués una expressió significativa a l’àrea neointimal que indiqués que la transferència del gen de la superfície de stent es va produir només a la fase inicial del desplegament . (d) Re-endotelialització dels vaixells després de la implantació de stent. Imatges SEM dels stents de la setmana 16. Els vaixells del grup Coated (-) mancaven de morfologia de cèl·lules endotelials entre puntes, mentre que les monocapa de cèl·lules endotelials cobrien completament la superfície de stent amb morfologia fusiforme típica i vores intactes en el grup Coated (+). (e) Re-endotelialització de seccions de teixit arterial en diferents stents a la setmana 16 desplegament de stent mitjançant una valoració histològica de. Les dades representen la mitjana ± SD (n = 8). ANOVA: *** = P <0, 001 i * = P <0, 05, mentre que el valor P en comparar Coated (+) i Coated (-) en (D) es denota amb ψ.

Imatge a mida completa

La regeneració endotelial es va determinar mitjançant tres metodologies independents: la tinció blava d’Evan, la microscòpia electrònica d’escaneig i la histologia. Dues setmanes després de la lesió de globus i de la col·locació de stent, es va valorar la regeneració endotelial en els animals tractats amb stents Coated (+) i Coated (-) mitjançant una tinció blava Evans ( n = 3 stent). La tinció luminal del blau d’Evans va demostrar que l’angioplàstia de globus i el procediment de stenting van denegar completament l’artèria femoral en stent Control (-) mentre que el revestiment (+) mostrava una recuperació marcada a la setmana 2 ( figura S7a ). Com es desprèn de la figura S7b, la re-endotelialització va ser significativament més gran en els vaixells revestits (+) (55, 36 ± 4, 64%) en comparació amb els vaixells de control revestits (-) (37, 5 ± 6, 51%, P <0, 05).

A més, a les dues setmanes i a les 16 setmanes després del desplegament de stent, es van fer imatges SEM de la superfície interior de les artèries stentades. Les cèl·lules coherents amb la morfologia endotelial es van observar a la superfície de les puntes de stent tractades amb Bac Vegf a la setmana 2, que van cobrir completament la superfície del stent després de 16 setmanes ( figura 3d ). En contraposició, es va observar a les artèries amb stent tractat amb Bac Vegf tant a la setmana 2 com a la setmana 16. Avaluació histològica de la regeneració endotelial, que consta principalment del puntal d’estent exposat i teixits neointima parcialment coberts, durant la setze setmanes posteriors a la col·locació de stent., va demostrar una diferència significativa en la regeneració endotelial entre els tres grups, els stents de control negatiu de metall nu negre no recoberts. El percentatge de cèl·lules endotelials observades en els vaixells revestits (+) va ser significativament més gran que en els vaixells de control (93, 5 ± 5, 2% davant 75, 4 ± 9, 3% i 72, 4 ± 4, 1; P <0, 05), com es mostra a la figura 3e .

Tots els vaixells van ser patentats angiogràficament i histològicament durant el període d’estudi. Tampoc es va detectar malaposició de stent en cap animal. 16 setmanes després de la transferència de gens Vegf específics al lloc, l’àrea estenòtica es va reduir significativament en Coated (+) en comparació amb els stents de grup no recoberts (54, 58 ± 14, 1% vs 85, 4 ± 10, 14%; P <0, 05) segons es va analitzar per l’angiografia ( Figura 4a i S7d ) utilitzant mètodes estàndard 39 . L’extensió de la lesió del vas al lloc de stent, analitzada per exàmens histològics 20, va ser similar en tots els grups segons la determinada per la puntuació de lesió (Recobert + 1, 13 ± 0, 14 vs Recobert-1, 15 ± 0, 27 vs No recobert 1, 21 ± 0, 35). També es van obtenir resultats similars amb la puntuació d’inflamació (Recobert + 0, 66 ± 0, 34 vs Recobert-0, 7 ± 0, 31 i No recobert 0, 81 ± 0, 45; p> 0, 05). És important destacar que l’anàlisi histomorfometrica ( figura 4b ) també va demostrar una hiperplàsia intimal o un estenosi percentual significativament reduïts en grup Coated (+) en comparació amb altres dos grups ( figura 4c, 61, 36 ± 15, 15% davant 78, 41 ± 13, 84 i 87, 66 ± 8, 54%; n = 8, P <0, 05). Es van obtenir resultats similars quan es van analitzar en termes d’àrea neoíntima mitjana de secció ( figura 4d, 2, 23 ± 0, 56 mm 2 vs 2, 78 ± 0, 49 mm 2 i 3, 11 ± 0, 23 mm 2 ; p <0, 05). 1 cm de proximitat i distal a la zona amb stent no mostraven signes de formació íntima.

Image

(a) L'efecte del lliurament de Bac Vegf -PAMAM sobre la ISR es va valorar mitjançant una anàlisi de l'angiografia. Comparació d’estudis d’angiografia a la setmana 16 després del desplegament de stent a les artèries femorals dels gossos. Imatges angiogràfiques representatives d’artèries femorals amb stent metàl·lic nu revestit i stents recoberts portant Bac Null -PAMAM i Bac Vegf -PAMAM a la setmana 16 després del desplegament de stent, amb fletxes blanques que mostren els bloquejos (pel·lícules suplementàries 1 i 2). (b) L'efecte del lliurament de Bac Vegf -PAMAM sobre la ISR avaluat mitjançant anàlisis histomorfometriques. Comparació d’estudis histomorfometrics a la Setmana 16 després del desplegament de stent a les artèries femorals de gossos. Imatges de seccions transversals representatives d’artèries femorals tinguides amb elàstica de Van Gieson amb stent de metall nu descobert i stents recoberts portant Bac Null -PAMAM i Bac Vegf -PAMAM a la setmana 16 després del desplegament de stent. L’anàlisi de l’estenosi (c) i l’àrea neointimal mitjana (d) a les regions estentades demostren una reducció significativa de la RSE en el grup Coated (+) en comparació amb els grups no recoberts i recoberts (-). Les dades representen la mitjana ± SD (n = 8). ANOVA: ** = P <0, 01; El valor P en comparar Coated (+) i Coated (-) es denota amb ψ.

Imatge a mida completa

Discussió

Segons el que sabem, aquest estudi demostra per primera vegada que els baculovirus recombinants generats per cèl·lules d’insectes poden utilitzar-se eficientment per a aplicacions de teràpia gènica basades en stent, com la inhibició de la ISR post-angioplàstia. Aquest treball s'ha centrat en dissenyar una nova estratègia anti-restenosi utilitzant un stent basat en elució gènica basat en baculovirus que millori la biologia de la paret del vaixell, al contrari de la disrupció vascular basada en fàrmacs, en accelerar la recuperació endotelial després del desplegament de stent. Les dades demostren la nostra hipòtesi demostrant una recuperació endotelial millorada significativament, avaluada per la microscòpia electrònica de tinció i exploració blava d’Evan i una ISR restringida il·lustrada per l’anàlisi histomorfometric i angiogràfic durant un període d’estudi de 4 mesos després de la implantació.

Fins ara, els baculovirus s’han considerat des de fa temps com un vector de lliurament de gens genèticament segur per a les cèl·lules de mamífers 27 . Tot i que s'ha demostrat que transdueix eficaçment les cèl·lules de mamífers in vitro , encara no està demostrat el seu ple potencial per a la teràpia gènica in vivo . Amb aquest treball, hem desenvolupat mètodes per protegir-lo del sistema immune immunitari i millorar la seva capacitat de transducció, que són les seves limitacions principals per a aplicacions in vivo . D'altra banda, la seva naturalesa transitòria de l'expressió gènica recombinant és ideal en un cas en què l'expressió cessa un cop finalitzat el treball. Això també confirma la seguretat del sistema per evitar efectes secundaris innecessaris en el període posterior a la curació. La disponibilitat de cèl·lules d’insectes hostes fàcils de cultivar i preparades per suspendre’s també facilita el procés d’escala. Com a tal, és més fàcil obtenir un alt nivell de baculovirus recombinants que altres virus de mamífers. Això fa que el sistema d’expressió del baculovirus sigui logístic i econòmicament viable per al desenvolupament de processos i la gran capacitat de producció.

Aquesta tecnologia pot ser una alternativa potencial als DES disponibles actualment, que utilitzen principalment fàrmacs anti-proliferatius. Aquests fàrmacs, tot i prevenint el sobrecrement de les cèl·lules musculars suaus, també condueixen a una regeneració incompleta de la capa endotelial danyada. The implication of the newly formulated bioactive stent will enhance the Vegf based rapid re-endothelialization mechanism 40 leading to better recovery process and reduced chance of restenosis. Moreover, the bioactivity of stent can be retained for at least 3 months once stored in the freezer, which further extends its commercial viability. In addition, the invention of the method documented here to effectively encapsulate functionally active baculoviruses also opens up the potential applications of recombinant baculoviruses for wider gene therapy applications. However, the present work does not demonstrate whether this system can inhibit long term in-stent thrombosis. An important area which needs further research is to characterize the in vivo dose dependant safety and efficacy analysis of the stent. In the present study we used a comparatively high dose of baculovirus nanohybrids. This is because, as a first study of its kind with no prior literature data, we aimed to achieve maximum transgene delivery at the stented site to achieve high growth factor expression, which can be a key determinant for the degree of vascular healing. Baculoviruses, with surface functionalized targeting ligands, can be the next step for this technology where the released viruses can site-specifically repair the denuded regions with minimal dosage. Furthermore, this advanced baculovirus based gene delivery system can be integrated with existing DES technology for combined stent based therapy of restenosis and thrombosis.

Taken together, the major findings of the current work capitalize on the development of this novel approach where local delivery of Bac Vegf -PAMAM nanobiohybrid vector, entrapped within PLGA MSs embedded layer-by-layer on fibrin-coated stent, can significantly enhance endothelial recovery and thereby block subsequent neointimal proliferation and ISR. Importantly, this transient nature of insect cell-originated baculovirus nanohybrid gene delivery system makes it a prospective biologically safe material for advanced translational research.

Mètodes

Generation of recombinant baculoviruses

The recombinant Vegf baculoviruses (Bac Vegf ) were generated by cotransfection of Sf9 insect cells with linearized baculovirus DNA (BD Baculogold) along with purified recombinant transfer vectors using cellfectin (Invitrogen Life Technologies, Carlsbad, CA) transfection reagent as mentioned in earlier study 24 . The viral titre [plaque forming unit (pfu)/mL] of the amplified viral stock was then determined using the Baculovirus Fast Plax Titer Kit (Novagen, Madison, WI) according to the manufacturer's protocol. Similarly, baculoviruses carrying MGFP gene (Bac MGFP ) and no transgene (Bac Null ) were also generated.

Formulation of bac-PAMAM nanohybrids

PAMAM dendrimer (generation 0) with ethylenediamine core (MW: 516.68) containing 4 surface primary amino groups was procured from Sigma Chemicals and resuspended in phosphate buffered saline (PBS). The concentration of PAMAM peptide stock solution was initially adjusted to 10 μmol in PBS solution. In order to form the PAMAM-baculovirus nanocomplex, the solutions of the PAMAM and baculoviruses were first brought to room temperature and adjusted to desired concentrations. Then the PAMAM solution and baculovirus solution were mixed according to a desired PAMAM/virus ratio (0, 0.01 μmol, 0.1 μmol, 0.5 μmol and 1.0 μmol PAMAM molecules per 10 8 baculovirus). The mixture was incubated at room temperature for 30 min to form complexes, with gentle vortexing from time to time. The mixture was further centrifuged at 24, 000 rpm for 45 min, and the pellet containing the heavier Bac-PAMAM nanocomplex was collected, leaving the unreacted excess dendrimer in the supernatant. The collected Bac-PAMAM was washed twice using PBS using the same centrifugation process. For every experiment, the preparation was freshly made.

Preparation of bioactive microparticles containing baculovirus nanohybrids

In order to encapsulate the the viral particles by water-oil-oil (w/o/o) double emulsion and solvent evaporation method 34, 5 × 10 13 pfu was resuspended in 100 μl of PBS containing 10% glycerol and 50 mg/ml BSA. The primary waterr in oil emulsion solution was prepared by homogenizing it in 1 ml of DCM containing 50 or 100 mg of PLGA [poly(D, L-lactic-co-glycolic acid)] and 1 ml acetonitrile for 1 min at 10, 000 rpm. The resulting primary emulsion was added to 5 ml of corn oil containing 2% span80 and homogenised for 3 min at 14000 rpm to form the secondary w/o/o emulsion. This solution was further agitated with a magnetic stirring bar in 10 ml of of corn oil containing 2% span80 for 4 h to evaporate the the DCM. The hardened PLGA microspheres were centirfuged at 9000 g for 10 min, washed thrice with PBS and stored temporarily at 4°C. In a similar way, PLGA microparticles were prepared by water-oil-water (w/o/w) method 34 . The method of PLGA microencapsulation of virus particles are demonstrated schematically in Figure S2 .

Preparation of bioactive stent using layer-by-layer coating

Firstly, the baculovirus was coated with PAMAM (0.5 μmol) and formulated in PLGA microspheres by w/o/o method. The prepared PLGA microspheres were resuspended in 5 mg/ml of bovine plasma derived fibrinogen, supplemented with aprotinin (20 μg/ml) to reduce fibrin degradation, and loaded in a 3 ml syringe with a 0.2-mm nozzle. The balloon expandable bare metal stainless steel stents with basic dimensions of 16 mm × 3.5 mm (Liberte Monorail stent, Boston Scientific, Mississauga, Ontario) was first mounted on a PTFE (polytetrafluoroethylene) mandrel that was driven by a rotator. The loaded aqueous fibrinogen mixture in the syringe was then gradually drip-coated on the surface of the mounted stent layer by layer (0.2 ml of Bac loaded aqueous fibrinogen per layer). In between every layer, 0.05 ml of thrombin solution (20 U/ml) was added all over the stent surface using a micropipette with 200 μl micropipette tip and waited for 15 min to form thin fibrin gel layer. Polymerization of the fibrin occurred around the stent which completely encased the stent ( Figure S1 ). The stent was subsequently coated with a top layer of fibrinogen (2.5 mg/ml) cross-linked with genipin (0.045 mg/mL final) followed by polymerization with thrombin. The process resulted in a microsphere impregnated fibrin coated stent loaded with 5 × 10 12 pfu Bac. The device was then crimped onto standard collapsed angioplasty balloon and delivered to the femoral artery. [The detailed methods for in vitro transduction and biofunctional studies are present in the Supplementary information .]

In vivo surgical procedures for arterial injury and stent implantation

All procedures were in compliance with the Canadian Council on Animal Care and McGill University animal use protocol, following all the ethical guidelines for experimental animals. Adult beagle dogs (Marshall Farms, North Rose, NY) weighing 9.5 to 11 kg were used in this study. A total of 30 stents were implanted bilaterally in deep femoral arteries of 15 dogs in a randomized, blinded fashion following denudation of the arterial endothelial wall, with contralateral arteries receiving stents from different groups. The animals were divided into three groups: fibrin coated stent loaded with microencapsulated PAMAM-Bac Vegf virus [Coated (+); n = 11 stents per group)], fibrin coated stent loaded with microencapsulated PAMAM-Bac Null virus [Coated (−); n = 11 stents per group] and bare metal stent (Uncoated; n = 8 stents per group). To confirm the transgene delivery and re-endothelization, animals from first two groups were sacrificed (n = 3) after 2 weeks and arteries were harvested. The remaining animals were sacrificed after 16 weeks for further analysis.

Denudation of the femoral arterial endothelial layer and stent implantation was performed according to the procedure performed in earlier studies 38 . The selected portion of artery lumens were flushed with PBS to avoid mixture with arterial blood. On the basis of angiograms, femoral segments with comparable diameters were selected on both legs so that the stent-to-artery diameter ratio remains approximately 1.3. After an arteriotomy, a fogarty arterial embolectomy balloon catheter (Edwards Lifesciences Canada Inc, Ontario) was infused through the saphenous arteries and advanced to the two preselected femoral segments and secured with a tie as mentioned elsewhere 29 . This was followed by severe balloon injury of the inner lumen of the artery with inflated balloon (balloon/artery ratio 1.2:1) to induce endothelial abrasion. Eventually the balloon catheter mounted stents were deployed at the site. 3 animals were euthanized at week 2, while the remaining at week 16.

Analysis of transgene expression

Anàlisi RT-PCR

At week 2 post stent placement, the stented femoral arteries (n = 3 stents/group) were harvested from Coated (+) and Coated (−) groups and divided laterally into three sections (proximal, mid and distal) after removing the stents. A part of the sections were used to detect hVegf transcript by RT-PCR, while the remaining parts were used for to detect the hVegf protein by immunostaining and reendothelization by staining. Similarly, sections were also collected at week 16. PCR amplification was performed on the reverse transcribed product using Taq DNA Polymerase (Invitrogen) and forward primer (5′CTTGCCTTGCTGCTCTACCTCC3′) and reverse primer (5′GCTGCGCTGATAGACATCCATG3′) for hVegf gene (112-bp product). Amplifications were carried out for 25 cycles at 94°C for 35 s (denaturation), 57°C for 35 s (annealing), and 72°C for 25 s (extension).

Immunohistochemical studies

For immunostaining rabbit anti-hVegf (Santa Cruz Biotechnology Inc., Santa Cruz, California) primary antibodies were used. Donkey anti-rabbit IgG-FITC was used as secondary antibody. The proportions and intensities of FITC-positive regions in the tissue sections, as seen under fluorescence microscope, gave a qualitative idea of the relative amount of hVegf expressed in the stented vascular tissue regions due to the transgene delivery from stent platform.

Assessment of stent re-endothelialization

Evans blue staining

Two weeks after stent deployment animals were anesthetized [ n = 3, Coated (+) and (−)] and a portion of the harvested artery was incubated in 1% Evans blue (Sigma-Aldrich) for 15 min, followed by washing, fixing and examining longitudinally using image software as mentioned elsewhere 20 .

Scanning electron microscope

Re-endothelialization was also assessed at 2 week and 16 week post implantation ( n = 3 each). Retrieved stents were washed with saline, fixed in 4% paraformaldehyde and longitudinally incised as above and examined using scanning electron microscopy (SEM).

Histological assessment

Stents were retrieved after twelve weeks and harvested vessels were embedded in methylmethacrylate plastic (Accel Lab Inc, Quebec, Canada and McGill SAIL Lab). After polymerization, the proximal, mid and distal sections of the stents were cut into 5 μm sections and stained with hematoxylin and eosin. Re-endothelialization was assessed directly under the microscope by a histologist blinded to treatment. Endothelial coverage was expressed as the percentage of the average lumen circumference covered by the endothelial cells 20 .

Assessment of ISR

Angiogram analysis

Initial and follow-up angiograms were performed with fluoroscopic angiography (GE Stenoscop) using Omnipaque Iohexol contrast dye in anterior oblique projection and percent diameter stenosis at follow-up was calculated by (minimal stent diameter at follow-up/the mean diameter of the stent at full expansion) × 100, using standard procedure as described elsewhere 39 . Sections were also used to evaluate the presence of inflammation and vessel wall injury at the stented sites of all the groups by injury and inflammation score method 20, 39 .

Morphometric analysis

Retrieved vessels were embedded in methylmethacrylate plastic, cut into thin sections as mentioned earlier, and stained with elastic Van Gieson stain. All sections were examined by light microscopy and photographed to quantify the neointima formation and stenotic area using methods mentioned elsewhere 20 .

Anàlisi estadística

Quantitative variables are presented as mean ± Standard Deviation (SD) from independent experiments as described in the figure legends. Statistics were performed using student's t-test or one-way ANOVA by Bonferroni's multiple comparison post-hoc test. All statistical analyses were performed with Prism 5 (GraphPad Software). P value <0.05 was considered significant.

Informació complementària

Fitxers PDF

  1. 1.

    Informació complementària

    Informació complementària

Comentaris

En enviar un comentari, accepteu complir els nostres Termes i Directrius de la Comunitat. Si trobeu alguna cosa abusiva o que no compleix els nostres termes o directrius, marqueu-la com a inadequada.