Xarxes metabòliques compensatòries en càncers de pàncrees després de la pertorbació del metabolisme de la glutamina comunicacions de natura

Xarxes metabòliques compensatòries en càncers de pàncrees després de la pertorbació del metabolisme de la glutamina comunicacions de natura

Anonim

Temes

  • Teràpies dirigides

Resum

L’adenocarcinoma ductal pancreàtic és un càncer notablement difícil de tractar i els pacients necessiten noves teràpies. Ja hem demostrat anteriorment que aquests tumors han alterat els requeriments metabòlics, fent-los altament confiats en diverses adaptacions que inclouen una via metabòlica no canònica de glutamina (Gln) i que la inhibició de components aigües del metabolisme de Gln condueix a una disminució del creixement del tumor. Aquí es va comprovar si els inhibidors de glutaminasa desenvolupats recentment (GLS), que media un primer pas en el metabolisme de Gln, representen una estratègia terapèutica viable. Mostrem que malgrat els primers efectes marcats en la proliferació in vitro causada per la inhibició del GLS, les cèl·lules cancerígenes del pàncreas tenen xarxes metabòliques adaptatives que sostenen la proliferació in vitro i in vivo . Utilitzem una plataforma metabolòmica i proteòmica integrada per comprendre aquesta resposta adaptativa i, per tant, dissenyar enfocaments combinatorials racionals. Demostrem que el metabolisme del càncer de pàncrees és adaptatiu i que l’orientació del metabolisme de Gln en combinació amb aquestes respostes adaptatives pot produir beneficis clínics per als pacients.

Introducció

L’adenocarcinoma ductal pancreàtic (PDAC) és una malaltia extremadament agressiva amb mal pronòstic 1 . Les opcions de tractament es mantenen en gran mesura inefectives amb una taxa de supervivència de 5 anys inferior al 8% (ref. 2). Per tant, les opcions de tractament noves són essencials. L'oncogeni de conducció de PDAC resulta de la mutació de Kras, que és present en> 90% dels tumors humans 3, 4, 5 . El nostre grup i altres han demostrat que el Kras oncogènic pot promoure un recalatge metabòlic de PDAC, incloent l’ús no canònic de glutamina (Gln) per ajudar a la proliferació mitjançant homoeòstasi redox 6, 7, 8, 9, 10 . La capacitat d’afrontar l’estrès oxidatiu és una característica definidora de molts càncers 11, 12, 13 i el microambient hipoxic i deficient de nutrients del PDAC suggereix que el manteniment de redox és essencial per a la proliferació del tumor. Com que el metabolisme de Gln és prescindible per a cèl·lules no malignes, però té un paper crític en l’homoeòstasi redox de PDAC, sembla que seria un candidat ideal per a l’orientació terapèutica9.

El primer pas de la glutaminòlisi està mediat per l’enzim glutaminasa (GLS), que catalitza la conversió de Gln en glutamat (Glu) al mitocondri on, en PDAC, el Glu derivat de Gln es metabolitza en última instància, produint un potencial reductor potencial en forma de augment del NADPH i del glutatió (GSH) 9 . La interrupció del metabolisme de Gln, mitjançant la inhibició del GLS (GLSi), produeix una disminució de la resposta antioxidant i una disminució de la proliferació cel·lular. Fins fa poc, els medicaments dirigits al GLS patien una deficient biodisponibilitat i una baixa potència 14 . CB-839 és un potent inhibidor oralment biodisponible del GLS, però no del GLS2 expressat en el fetge (ref. 15) que ha mostrat eficàcia en models de càncer de ratolí incloent carcinoma hepatocel·lular impulsat per Myc, limfoma i càncer de mama, però eficàcia limitada en càncer de pulmó de ratolí. models 16, 17, 18 . Els assajos clínics en fase inicial en curs estan estudiant l'eficàcia de CB-839 en càncers hematològics i sòlids.

Una qüestió destacada en PDAC és si GLSi és una estratègia terapèutica viable, ja que és l’enzim més proximal de la via del metabolisme Gln específic per a PDAC, i com pot diferir de l’orientació a parts distals de la via 9 . Això pot ser particularment rellevant ja que els tumors pancreàtics tenen la capacitat d’escapar les fonts de combustible a través de múltiples processos incloent autofagia, macropinocitosi i captació d’aminoàcids lliures alliberats per cèl·lules estromals 19, 20, 21, 22, 23 . En aquest estudi, mitjançant la integració de proteòmics i perfils metabòmics, caracteritzem els mecanismes adaptatius que pot utilitzar PDAC per mitigar els efectes de l’orientació de les vies metabòliques i proporcionar una prova crítica del concepte que l’orientació d’aquestes vies compensadores pot tenir utilitat terapèutica.

Resultats

GLSi té activitat antiproliferativa a les cèl·lules PDAC

Basant-nos en els resultats anteriors, vam avaluar per primer cop el paper del metabolisme de Gln en les cèl·lules PDAC, perjudicant l’activitat del GLS mitjançant la interferència de l’ARN. La derrota de GLS va reduir significativament el creixement de PDAC, tal com es mostrava anteriorment pel nostre grup 9 (Fig.1a, P <0.001, test t , figura suplementària 1a). Com els resultats anteriors també mostraven un efecte anti-proliferatiu de l’inhibidor del GLS BPTES (bis-2- (5-fenilacetamido-1, 2, 4-tiadiazol-2-il) sulfurs d’etil) (figura suplementària Fig. 1b), ens interessava a l'examen de l'eficàcia del CB-839, una potència més alta i un inhibidor del GLS 15 biodisponible per via oral. CB-839 va tenir un efecte potent en la proliferació de múltiples línies cel·lulars PDAC, incloent cèl·lules derivades de tumors primaris d’un LSL-Kras G12D ; p53 L / +, model de ratolí Pdx1-Cre de PDAC (MPADC-4) 24, amb IC50s en el rang nanomolar baix (Fig. 1b, c). En canvi, una línia de cèl·lules de fibroblast embrionari d’un ratolí i una línia de cèl·lules de fibroblast pulmonar humà (IMR90) eren relativament insensibles a CB-839 (Fig. 1c, d). El tractament CB-839 va reduir significativament el creixement de PDAC a diverses línies cel·lulars, tal com es va provar en un assaig de proliferació de diversos dies (Fig. 1d, e i Fig. Suplementari Fig. 1e – h, P <0, 002, test- t ). Per demostrar l’activitat a la meta del CB-839, vam rescatar la proliferació de línies cel·lulars PDAC afegint l’excés de Glu, el producte final del GLS (Fig. 1d, e). Les línies PDAC també eren sensibles al tractament CB-839 en medis RPMI, així com en la cultura 3D (figura suplementària Fig. 1i, j). Hem assenyalat que, a diferència dels informes previs de CB-839 en línies cel·lulars de càncer de mama triple negatiu, les línies cel·lulars PDAC no presentaven mort cel·lular ni apoptosi (Fig. 1f, g) 15 . A continuació, es va examinar l'efecte del GLSi sobre els nivells de metabòlits intracel·lulars en les línies cel·lulars PDAC. Com era d’esperar, a les 6 hores post-tractament CB-839 de MPDAC-4 i una línia de cèl·lules PDAC humanes, es van acumular significativament els nivells de Gln i els nivells de Glu (Fig. 1h, Fig Suplementària 1k, P <0, 05, per a tot, la prova. ). A més, CB-839 va reduir els nivells de diversos metabòlits aigües avall de Glu incloent aspartat (Asp), α-cetoglutarat (α-KG), GSH, malat i succinat.

Image

( a ) Proliferació relativa de cèl·lules PaTu-8988T que expressen un shRNA de control o shRNAs a GLS (# 1 i # 2). Les dades es representen com a proliferació cel·lular relativa en unitats arbitràries. Les barres d’error representen ± sd de tres pous independents d’un experiment representatiu (de quatre experiments). ( b, c ) Corbes de resposta a dosis i resposta a la proliferació cel·lular per a PaTu-8988T ( b ) i MPDAC-4 ( c ) tractades amb CB-839 durant 72 hores. La línia guionada indica el senyal relatiu del reporter en el moment de l'addició del CB-839. Les barres d’error representen ± sd de tres pous independents d’un experiment representatiu (de tres experiments). ( d, e ) Proliferació relativa de les línies cel·lulars PDAC, PaTu-8998T ( d ) i MPDAC-4 ( e ) tractades amb CB-839 (100 nm) o DMSO. Com s'ha indicat, es va afegir glutamat (Glu, 4 mM) als mitjans al moment de l'addició de CB-839. Les barres d’error representen ± sd de tres ( d ) o quatre ( e ) pous independents d’un experiment representatiu (de quatre experiments). ( f ) Viabilitat de cèl·lules PaTu-8988T, determinada per assaig d'exclusió blava trypan a 72 h després de DMSO i CB-839. Controls positius per staurosporina (1 μm) i H 2 O 2 (1 mM) durant 3 h. Les dades es representen com a mitjana ± sd de tres pous independents d’un experiment representatiu (de quatre experiments). ( g ) Anàlisi de blot occidental de Caspase-3 per a extracció de cèl·lules PaTu-8988T a 72 hores després de DMSO o CB-839. Controls positius amb staurosporina tractats durant 3 h. ( h ) Abundància relativa de metabòlits en cèl·lules MPDAC-4 després de 6 h de tractament CB-839. Les dades es presenten com a concentracions mitjanes de metabòlits totals ± sd de tres pous independents d'un experiment representatiu (de tres experiments). Per a tots els plafons, la importància es determina amb la prova t . * P <0, 05, ** P <0, 01, *** P <0, 001, ns: no significatiu, P > 0, 05.

Imatge a mida completa

GLSi no té cap efecte antitumoral en un model de ratolí de PDAC

A partir de l’efecte antipoliferatiu de CB-839 en sistemes de cultiu de cèl·lules PDAC, ens va interessar provar l’eficàcia de GLSi in vivo en un model de ratolí autòcton resistent al tractament de PDAC (LSL-Kras G12D ; p53 L / + ; Pdx1 -Cre) que imita de prop la condició humana 20, 24, 25 . Primer es va determinar el perfil farmacocinètic i farmacodinàmic de CB-839 en ratolins amb tumors identificats mitjançant ecografia 26 . El CB-839 es va administrar a 200 mg kg- 1, una dosi prèviament determinada 15 . El tumor i el plasma es van recopilar 4 hores després de la dosificació i es van observar concentracions de CB-839 de> 2 nmol g 1 o μmol l 1 (Fig. 2a). Això es va associar amb una supressió significativa de l’activitat del GLS en els tumors (Fig. 2b, P = 0.01130, t- test) i els canvis esperats en els metabòlits (Fig. 2c). Posteriorment es va realitzar un assaig clínic de ratolí CB-839 enfront del control del vehicle amb la supervivència global com a punt final principal. També es va controlar el creixement del tumor mitjançant ultrasons en sèrie com a punt final secundari. Com es mostra a la figura 2d, no hi hagué cap millora significativa en la supervivència amb CB-839 amb ratolins tractats amb CB-839 que mostraven efectivament un temps de supervivència medial marginalment més curt que els animals tractats amb vehicles (20 versus 24 dies, P = 0.3441). A més, els ratolins tractats amb CB-839 van desenvolupar tumors pancreàtics secundaris ( P = 0, 0335) i van tenir una tendència a l'augment de la malaltia macrometastàtica ( P = 0, 1819) (figura suplementària 2a, b). Es va observar el desenvolupament de tumors secundaris tan aviat com cinc dies després de l’inici de la CB-839 (figura suplementària Fig. 2c). A causa de la ràpida cinètica de la formació de tumors secundaris amb GLSi, vam raonar que els tumors secundaris van sorgir de les lesions intraepitelials pancreàtiques en fase tardana o PDAC precoç (en contraposició a la metàstasi en trànsit) no detectables per ultrasons, però probablement presents per la naturalesa dels ratolins amb expressió a tot el pàncrees de Kras oncogènic i heterozigositat p53. Atès que es va desenvolupar un tumor secundari en una majoria de ratolins tractats amb CB-839, la cinètica del creixement del tumor primari no es va poder determinar amb precisió mitjançant ultrasons. Sembla que els tumors primaris van progressar malgrat el tractament amb CB-839 basat en una mesura d’ecografia inicial i en mesures de tumors directes a l’autòpsia. Els tumors secundaris i la malaltia macrometastàtica es van confirmar com adenocarcinoma, no apareixien morfològicament diferents de la primària, i tenien nivells adequats de medicament i GLSi (figura suplementària 2d-j). Es va provar els marcadors de la transició epitelial-mesenquimal (EMT) per determinar si el tractament amb CB-839 va iniciar un fenotip EMT que podria donar compte de l’augment de metàstasis. Els marcadors EMT de tumors primaris eren probablement altament variables que reflectien l’heterogeneïtat cel·lular dins dels tumors (figura suplementària Fig. 2k). Tot i que els marcadors EMT van ser lleugerament elevats amb el tractament CB-839 en cultiu cel·lular, tots aquests resultats no donen suport constantment a un paper clar per a l’EMT en aquest procés (figura suplementària Fig. 2l). Tot i que els esforços (figura suplementària Fig. 2, mètodes) per determinar la causa d’aquest fenomen no es revelaven, la naturalesa del model amb omnipresent expressió pancreàtica de Kras oncogènic permetrà futurs estudis que puguin revelar la base molecular d’aquest fenomen. Tenint en compte l'efecte paradoxal del GLSi en el model autòcton, que no presenta respostes tumorals objectives, malgrat les respostes robustes in vitro , es va plantejar la hipòtesi que o bé el microambient del tumor pancreàtic o més simplement el medi in vivo pot influir en la resposta metabòlica del PDAC.

Image

( a ) nivells de CB-839 mesurats per LC / MS-MS en mostres de plasma i tumor 4 hores després de la dosificació oral de 200 mg kg -1 CB-839 de LSL-Kras G12D ; p53 L / +, ratolins Pdx1-Cre que porten tumors pancreàtics (plasma, n = 5 ratolins independents; tumor, dues peces separades de cada tumor de cinc ratolins, n = 10). Les dades es representen com a mitjana ± sem ( b ) Activitat de glutaminasa mesurada en lisats tumorals d’animals ( n = 4 per grup) tractats amb vehicle o CB-839 com a ( a ). La representació del percentatge d'inhibició per part del CB-839 respecte al vehicle es mostra, n = 4. Les dades es representen com a mitjana ± sem ( c ) Abundància relativa de metabòlits en lisats tumorals d’animals tractats com a ( a ) (2-3 trossos de tumor de cinc ratolins per grup, n = 11 vehicle tractat, n = 10 CB-839 tractats) . Les dades es presenten com a grups de metabòlits totals mitjans ± sem ( d ) Anàlisi Kaplan – Meier que compara la supervivència del vehicle (negre, n = 11) i CB-839 (vermell, n = 13) tractat amb LSL-Kras G12D ; p53 L / +, ratolins Pdx1-Cre que porten tumors pancreàtics. No es va produir cap efecte significatiu en la supervivència ( P = 0.3441 mitjançant la prova de log-rank (Mantel-Cox)). Per als panells b, c, significació determinada per t- test, * P <0, 05, ** P <0, 01, *** P <0, 001, ns: no significatiu, P > 0, 05.

Imatge a mida completa

Per provar aquestes possibilitats, es van utilitzar models de trasplantament que ens permetrien avaluar l'impacte del creixement in vivo en diferents entorns. Primer es va examinar l'eficàcia del CB-839 en un model ortotòpic de PDAC. Vam implantar la línia cel·lular MPDAC-4 altament sensible CB-839 (Fig. 1c, e) a la pancreata de ratolins nus i tractada amb CB-839. No es va produir un retard significatiu en el creixement del tumor com es va controlar la imaginació de la luciferasa o el pes del tumor final (Fig. 3a, b, P = 0.3412, P = 0.8845, respectivament, t- test). Per entendre si el canvi marcat de sensibilitat al tractament CB-839 in vivo es va deure al microambient pancreàtic, vam trasplantar a continuació la línia cel·lular MPDAC-4 per via subcutània i vam tractar ratolins amb tumors amb CB-839. Similar a l'experiment ortotòpic, no hi va haver un retard significatiu en el creixement del tumor en els ratolins portadors de tumors de flanc MPDAC-4 (Fig. 3c, P = 0, 0957, t- Test). També es va examinar el creixement del tumor dels xenografts del flanc PDAC humà i no es va detectar cap retard significatiu en el creixement del tumor (Fig. 3d, P = 0.7241, t- test). Per descartar el lliurament de fàrmacs inadequat com a causa de la falta de retard en el creixement del tumor, vam mesurar els nivells de fàrmacs plasmàtics CB-839 al punt final de l’experiment de tumor de flanc MPDAC-4 i vam observar nivells adequats de medicaments CB-839 . Cal destacar, no es va trobar cap evidència de tumors secundaris en pàncrees en l'experiment ortotòpic ni desenvolupament de dipòsits de tumors metastàtics ni en experiments ortotòpics ni en flancs que suggereixin que aquest fenomen del model autòcton es va deure a la naturalesa del model, més que una situació fisiològica. En conjunt, aquestes dades donen suport a la idea que els tumors PDAC in vivo no responen al GLSi i això no depèn de la ubicació on es creixi el tumor.

Image

( a ) Les cèl·lules MPDAC-4 que expressaven la luciferasa expressivament, es van implantar a la pancreata de ratolins nus. A continuació, els ratolins van ser aleatoritzats amb tractament CB-839 (200 mg kg −1, dues vegades al dia) o tractament control (vehicle) ( n = 13 braç de vehicle, n = 16 braç CB-839) i es van imaginar setmanalment amb imatges de luciferasa. La fletxa indica l’inici del tractament. Les dades es van expressar com a flux total mitjà (p / s) ± sem La prova t es va realitzar al punt final, P = 0.3142. ( b ) Pes del tumor dels ratolins al punt final de la prova a ( a ) presentat com a mitjana ± sem P = 0, 8845 ( t- test). ( c ) Les cèl·lules MPDAC-4 es van implantar per via subcutània a ratolins nus i després que la mida mitjana del tumor de la cohort arribés a 50 mm de ratolins es randomitzessin i es tractessin tal com s'indica amb el vehicle o CB-839 (200 mg kg −1, dues vegades al dia), (vehicle, n = 14; CB-839, n = 13). Els tumors es mesuraven dues vegades per setmana. Les barres d'error representen ± sem Un test t es va realitzar al punt final, P = 0.0957. ( d ) Les cèl·lules PaTu-8988T es van cultivar com a tumors de xenograft als flancs de ratolins nus, els ratolins van ser aleatoritzats i tractats com a ( c ). Els tumors es van mesurar setmanalment (vehicle, n = 9; CB-839, n = 8). Les barres d'error representen ± sem Un test t es va realitzar al punt final, P = 0.7241. ( e ) nivells de CB-839 en plasma de ratolins portadors de tumor MPDAC-4 tractats amb CB-839 a ( c ), mesurats al punt final, n = 13. Les dades es presenten com a mitjana ± sem

Imatge a mida completa

El perfilat metabòlic GLSi identifica vies regulades

Una possible explicació per a la ineficàcia de CB-839 in vivo va ser una resposta adaptativa a l’exposició crònica de GLSi. Per modelar aquest escenari, es van realitzar assajos de proliferació a llarg termini in vitro amb CB-839. En consonància amb aquesta hipòtesi, les línies PDAC van restablir la seva velocitat proliferativa inicial en punts de temps posteriors, fins i tot a concentracions més altes de CB-839, cosa que suggereix alguna resposta adaptativa (Fig. 4a, Fig. 3a, b). El tractament a llarg termini amb BPTES va revelar troballes similars (figura suplementària Fig. 3c). Per determinar la naturalesa d’aquesta resposta adaptativa, es van examinar grups de metabòlits relatius a les cèl·lules MPDAC-4 tractades amb CB-839 en diversos moments (Fig. 4b, Dades complementàries 1). En examinar els metabòlits immediatament aigües amunt i avall del GLS, vam observar que a 72 h les cèl·lules van mantenir un augment significatiu dels nivells de Gln, així com una disminució en Asp i malat (Fig. 4c, P <0, 05, t- test). Tot i això, en contrast amb el tractament a curt termini (Fig. 1h), aquestes cèl·lules ja no es mostren disminució de Glu, α-KG, GSH i succinat (Fig. 4c). L’anàlisi d’enriquiment del conjunt de metabolits dels metabòlits no regulats i baixats (Fig. 4d, figura suplementària 3d, dades suplementàries 2) va revelar un enriquiment en biosíntesi de proteïnes, metabolisme d’aminoàcids i oxidació de termes de metabolisme d’àcids grassos en cadena ramificada en el conjunt de metabòlits regulats (Fig. 4d). Metabòlits implicats en l’oxidació del metabolisme d’àcids grassos en cadena ramificada incloïen propionilcarnitina, acetilcarnitina i C5-carnitines (2-Metilbutiroilcarnitina i isovalerylcarnitina) (Fig. 4e).

Image

( a ) Proliferació relativa de la línia cel·lular MPDAC-4 tractada a llarg termini amb CB-839 (1 μm) o DMSO. Com s'ha indicat, el CB-839 es va refrescar a la part mitjana de l'experiment. Les barres d’error representen ± sd de quatre pous independents d’un experiment representatiu (de quatre experiments). ( b ) Placa de calor de registre 2 (mostra / control tractat amb CB-839) per a metabòlits mesurats a partir de cultiu cel·lular MPDAC-4 (a 4, 24 i 72 h) i experiment de tumor xenogràf de MPDAC-4 de la figura 3c. Els valors presentats per a les dades de cultiu cel·lular són la mitjana de tres pous independents d’un experiment representatiu (de tres experiments). Els valors presentats pel tumor són la mitjana de cinc tumors independents. ( c ) Abundància relativa de metabòlits en cèl·lules MPDAC-4 després del tractament amb 72 h CB-839. Les dades es presenten com a mitjans de concentracions de metabòlits totals ± sd de tres pous independents a partir d’un experiment representatiu (de tres experiments). ( d ) Anàlisi d’enriquiment de conjunts de metabolits (MSEA) de metabòlits no regulats procedents de l’experimentació metabòlica MPDAC-4 72 h CB-839, tal com es realitza a ( b ), termes estadísticament significatius s’agafen segons l’enriquiment de plecs (nombre de metabòlits representats a terme entre parèntesis. ). ( e ) Nivells de metabolits relatius (mostra / control tractat amb CB-839) mostrats per a metabòlits de carnitina dels experiments de cultiu cel·lular (MPDAC-4, PaTu-8988T), mitjà de piscines de metabòlits totals ± sd de tres pous independents d'un experiment representatiu (de tres experiments)) i experiment de tumors MPDAC-4 (tumors de l’experiment descrits a la Fig. 3c, mitjà de piscines de metabòlits totals ± sd, n = 5 tumors independents). ( f ) Abundància relativa de metabòlits en tumors de flanc MPDAC-4 com a la figura 3c després del tractament a llarg termini CB-839, n = 5 tumors per grup, les barres d'error representen sem Totes les comparacions no significatives, P > 0, 05. ( g ) Anàlisi d'enriquiment de metabolits (MSEA) de metabòlits significativament regulats a partir de l'experiment metabòlic del tumor CB-839 del tumor MPDAC-4. Per a c, e i f, significació determinada per t- test, * P <0, 05, ** P <0, 01, *** P <0, 001, ns: no significatiu, P > 0, 05.

Imatge a mida completa

Per entendre millor els canvis adaptatius de la resposta metabòlica, es va utilitzar un traçat de Gln ([U- 13 C 5 ] Gln) amb una etiqueta uniforme de 13 C per identificar l’itinerari dels carbons derivats de Gln en control respecte a les condicions tractades amb CB-839. El tractament a curt termini (6 h) va revelar disminucions de les quantitats absolutes de la majoria d’espècies de Glu, així com de diversos altres metabòlits aigües avall (inclosos Asp i malat), però increments relatius en Glu no etiquetat, cosa que indica un augment de les vies alternatives per a Glu (Fig complementari . 3e, f, Dades complementàries 3). En punts posteriors (72 h), el traçat de Gln va mostrar un augment de les quantitats relatives i absolutes de Glu no etiquetat, així com d'altres metabòlits aigües avall (derivats de Gln) que indiquen un augment de les vies alternatives per a la producció de metabòlits Glu i relacionats (complementari Fig. 3e, f, Dades complementàries 3). Al mateix temps, un augment del Glu derivat de Gln també va suggerir algunes vies dependents de Gln (però no necessàriament depenent del GLS) que contribuïen a l'augment de la línia base de Glu.

El perfil metabolòmic de cèl·lules PDAC humanes va revelar un enriquiment similar en l’oxidació del metabolisme d’àcids grassos en cadena ramificada (Fig. 3g, Fig. 4e suplementari). Curiosament, malgrat un restabliment similar de la capacitat proliferativa com les cèl·lules PDAC del ratolí, les cèl·lules PDAC humanes van mantenir disminucions significatives de Glu, Asp, α-KG, malat, GSH, succinat i citrat després de 72 h de tractament CB-839 (figura suplementària Fig. 3h, P ≤0.02, per a tothom, t- test) que suggereix que el moment in vitro relatiu del tractament o la naturalesa general de la resposta metabolòmica adaptativa a GLSi pot diferir entre càncers de pàncrees individuals. Totes aquestes dades mostren que privar les cèl·lules PDAC de la seva font de carboni preferida per Glu condueix als intents de la cèl·lula per obtenir carboni de vies alternatives. A més, la resposta a la pertorbació de vies metabòliques en el cultiu cel·lular pot predir les vies metabòliques de les quals els tumors PDAC depenen in vivo , quan es valoren durant un període més llarg per permetre l'adaptació que es produirà in vivo . De fet, l’anàlisi de metabòlits de tumors de xenograft PDAC de ratolí i tumors autòctons de ratolins tractats a llarg termini (> 2 setmanes) amb vehicle o CB-839, va revelar un augment continuat de Gln en tumors tractats amb CB-839, però no hi ha diferències significatives en els metabòlits bàsics ( Fig. 4f, P ≥0.1, per a tots, t- test, figura suplementària Fig. 3i). En consonància amb els estudis in vitro , els metabòlits implicats en l’oxidació d’àcids grassos de cadena ramificada (Fig. 4g) també es van augmentar en tumors tractats amb CB-839 (Fig. 4b, e). La disminució primerenca de Glu i d’altres metabòlits, combinada amb la reaccumulació d’aquests metabòlits en un moment posterior, així com d’altres canvis específics observats (augment de les carnitines associades al metabolisme dels àcids grassos), suggereix una certa confiança en Glu derivat del GLS que es rescata. per una via / vies metabòliques alternatives.

La proteòmica quantitativa del GLSi revela vies compensatòries

Per determinar encara més la naturalesa de la resposta adaptativa, es va utilitzar una espectrometria de massa quantitativa basada en etiquetes isobàriques multiplexades per analitzar la resposta proteòmica al tractament CB-839 27 . Primer hem comparat els proteomes de cèl·lules CB-839 no tractades, amb cèl·lules MPDAC-4 de 24 h i 72 h (Fig. 4a, Suplementari de dades 4). La magnitud dels canvis en el conjunt de dades de tractament CB-839-24 h era inferior a la CB-839-72 h, probablement degut al punt de temps anterior i a un retard en el canvi d’expressió de proteïnes en resposta al GLSi, com demostrava el principal. anàlisi de components (PCA) (Fig. 5a – c). A mesura que es van identificar la majoria dels canvis en el temps de 72 h, es va fer una anàlisi d’enriquiment de conjunts genètics (GSEA) comparant el tractament tractat amb DMSO amb el tractament 72 h CB-839 de 72 h (Dades complementàries 5, veure mètodes) i es van analitzar els resultats mitjançant un mapa d’enriquiment estratègia 29 per determinar la resposta global al tractament CB-839 (Fig. 5d). Els nodes del mapa d’enriquiment associats a proteïnes regulades van incloure la resposta a l’estrès oxidatiu, el metabolisme dels àcids grassos i els lípids, la glicòlisi, la fosforilació oxidativa, el metabolisme dels aminoàcids i els processos lisosòmics (Fig. 5d, Dades complementàries 5). El marcat enriquiment dels processos relacionats amb lípids i àcids grassos va resultar intrigant donat els resultats de les anàlisis metabolòmiques i està en línia amb el metabolisme de Gln que recolza la síntesi d’àcids grassos 30 . A més, es va observar una major expressió de múltiples proteïnes implicades en la resposta a l'estrès oxidatiu (Fig. 5e, Fig. 4b suplementària). També es van mesurar els canvis de proteoma en una línia de cèl·lules sensibles a CB-839, PaTu-8988T (Dades complementàries 6). Vam veure canvis similars respecte a la regulació superior de les proteïnes de resposta a l'estrès oxidatiu. Tot i que no es van produir canvis marcats en tots els objectius de la resposta de resposta antioxidant de Nrf2, hi va haver una certa participació de la ruta de Nrf2 en aquesta resposta (figura suplementària Fig. 4c). En línia amb una disminució de la capacitat proliferativa i de resposta a l'estrès en GLSi, els termes GSEA associats a proteïnes regulades en cicle cel·lular, metabolisme d'ARN i ADN, transcripció, traducció i nodes plegats de proteïnes (Fig. 5d, Dades complementàries 5).

Image

( a, b ) Les parcel·les de volcans il·lustren diferències d’abundància de proteïnes significativament estadístics en les cèl·lules MPDAC-4 tractades amb CB-839 durant 24 h ( a ) o 72 h ( b ). Les parcel·les de volcans mostren el –log 10 (valor P ) respecte al registre 2 de l’abundància de proteïnes relativa de ( a ) tractament mig CB-839 a 24 hores o ( b ) tractament CB-839 72 h mitjà per control mitjà (DMSO). Els cercles vermells representen les proteïnes regulades més altes del 5% amb un valor P <0, 05, els cercles blaus representen el 5% de proteïnes més regulades i un valor P <0, 05. La resta de proteïnes es representen com a cercles grisos. Les dades provenen de tres plaques independents d’un experiment representatiu de tres experiments. ( c ) Anàlisi del component principal dels proteomes tractats CB-839 representats en un espai bidimensional. ( d ) El mapa d'enriquiment de l'anàlisi d'enriquiment de conjunts de gens (GSEA) de CB-839-72 h enfront de DMSO, FDR0.25, la mida del node està relacionada amb el nombre de components identificats dins d'un conjunt genètic i l'amplada de la línia és proporcional a la solapament entre conjunts de gens relacionats. Els termes GSEA associats a proteïnes regulades (vermell) i regulades (blau) es coloreen en conseqüència i s’agrupen en nodes amb termes associats. ( e ) Les proteïnes de la xarxa de proteïnes de resposta a l'estrès oxidatiu estan regulades en resposta al tractament CB-839. Els gràfics representen la mitjana de Log 2 (mostra / control tractat CB-839) dels experiments de MPDAC-4 Experiments 1-3 de proteïnes selectes en vies de resposta a l'estrès oxidatiu ( n = 9, tres plaques independents per a cada Experiment 1-3). Les barres d’error representen ± sem Uregulades (vermell), regulades a baix (blau), sense cap canvi relatiu (gris). Abreviacions: ALDH1L2: Aldehid Deshidrogenasa 1 Membre de la família L2, GSR: Glutatió reductasa, mitocondrius, GLS: Glutaminasa, GLS2: Glutaminasa 2, CTH: Cistathionina gamma-liasa, GCLC: subunitat reguladora del catalític de catalítica de glutamasa ligatina cisteïna: glutamat-cisteïna subunitat, GPX1: Glutatió peroxidasa 1, GSTT3: Glutatió S-transferasa Theta 3, MTX: Metotrexat, BSO: L-Butionina- S, R- sulfoximina.

Imatge a mida completa

Tenint en compte la reaccumulació de Glu en cèl·lules tractades amb CB-839, també ens interessava examinar els nivells d'enzims productors de Glu. A les cèl·lules MPDAC-4 a 72 hores, el GLS i el GLS2, normalment expressats al fetge, no estan regulats ni amunt ni regulats constantment (figura suplementària Fig. 4d, dades suplementàries 7). També es van examinar els canvis en Gln amidotransferases que podrien tenir en compte la reacumulació de Glu completament etiquetat (M + 5, Fig. 3e suplementari). Entre les Gln amidotransferases, l’asparagina sintetasa (ASNS) va augmentar significativament després del tractament amb CB-839 que suggeria que l’ASNS pot contribuir a la reaccumulació de Glu en la configuració de GLSi (Fig. 4e suplementària, P = 5.56E-11, t -test, Dades complementàries 7 ). Cal destacar que ASNS també ha estat implicada en la supervivència cel·lular després de la retirada de Gln mitjançant múltiples mecanismes 31, 32 . Tot i que no és una mesura de flux, les Gln amidotransferases restants eren properes a les mesures basals (Dades complementàries 7). Altres enzims productors de Glu independents de Gln es van augmentar a les cèl·lules MPDAC-4 incloent l’aminotransferasa 1 de cadena ramificada (BCAT1), l’alanina aminotransferasa 2 (GPT2), la Gamma-Glutamil hidrolasa (GGH) i la 5-oxoprolinasa (OPLAH), suggerint vies alternatives. per a la producció de glu que no depèn del GLS (figura suplementària 4f, dades suplementàries 7).

En conjunt, la resposta metabòmica i proteòmica a GLSi reflecteix el nombre complex i la varietat de processos cel·lulars en què està involucrat el metabolisme de Gln 30, 33 . De fet, una anàlisi metabolòmica i proteòmica integrada va confirmar la importància tant del metabolisme de la GSH com dels àcids grassos, així com de diverses vies metabòliques addicionals en la resposta a GLSi (figura suplementària Fig. 5a, dades suplementàries 8) 34 .

La proteòmica GLSi prediu tractaments combinatius racionals

Basant-nos en canvis metabòlics i proteòmics, ens va interessar si els enfocaments combinatorials racionals podrien conduir a sinergies o resposta sostinguda al tractament. Ens va interessar en primer lloc la regulació de proteïnes de resposta a l'estrès oxidatiu, donades dades anteriors que mostren la importància del metabolisme de Gln en PDAC per donar suport a l'homoeòstasi 9 redox, així com la sinergia amb agents que s'esgoten NADPH 35 . Com es va demostrar anteriorment, les cèl·lules PDAC inhibides per a la glutaminòlisi van tenir increments significatius de ROS en punts primerencs després de GLSi (Fig. 6a, P = 0.02329, test- t , Fig. Suplementari Fig. 5b, P = 0.00208, t- test). Tanmateix, en el tractament a llarg termini i en cèl·lules resistents a CB-839 (CB-839-R: cèl·lules tractades amb CB-839 durant més de 15 dies que van reprendre la proliferació), els nivells de ROS van disminuir a prop de la línia inicial que suggereix una resposta adaptativa a tractament (Fig. 6a, Suplementari Fig. 5b). A més, inicialment els nivells de GSH van disminuir significativament, tal com es va reduir a la proporció oxidada i aquests van tornar a la línia de base a les cèl·lules CB-839-R (Fig. 6b, P ≤0.003, per a tot, t- test). En línia amb aquests resultats, la N- acetil cisteïna va rescatar parcialment la proliferació cel·lular quan es va afegir al principi de la inhibició del CB-839 i el peròxid d’hidrogen afegit a CB-839 va produir una resposta sinèrgica (Fig. 6c, d). A partir de l’elevació sostinguda de proteïnes implicades en la resposta anti-oxidant (CTH i ALDH1L2, Fig. 5c), vàrem predir que l’orientació de les vies redox relacionades en combinació amb CB-389 pot produir una resposta sinèrgica. Tenint en compte la manca d’inhibidors potents de CTH, vam optar per utilitzar la L -Butionina- ( S, R) -sulfoximina (BSO), un inhibidor de la γ-glutamilcisteïna (GCLC / GCLM), que és aigües avall de CTH i important per a la síntesi de GSH (Fig. 5e) 11, 36 . Es va provar la combinació de CB-839 i BSO tant en punts inicials com en cèl·lules resistents a CB-839. Tot i que el BSO d’un agent únic no va tenir cap efecte sobre les cèl·lules, el co-tractament va abolir el regrupiment de les cèl·lules tractades amb CB-839 (Fig. 7a, Fig. 5d suplementària). A més, el tractament combinatiu de BSO i CB-839 en cèl·lules CB-839-R també va disminuir la proliferació (Fig. 7b). Així mateix, es va provar la inhibició de les vies de folats relacionades amb ALDH1L2 importants per a la producció de NADPH amb metotrexat, un inhibidor de la dihidrofolata reductasa. Combination therapy showed an additive effect of methotrexate and a blunting of the CB-839 resistance phenotype (Fig. 7c, d).

Image

( a ) Relative CellRox intensity in MPDAC-4 cells following CB-839 treatment at the indicated times as measured by flow cytometry. Data are presented as mean±sd of three independent wells from a representative experiment (of three experiments). ( b ) Total glutathione levels (left) and ratio of reduced to oxidized (right) after CB-839 treatment. Data are presented as mean±sd of three independent wells from a representative experiment (of three experiments). ( c ) Relative proliferation of MPDAC-4 cell line treated with CB-839 or DMSO with or without N -acetyl cysteine (2 mM). Data are plotted as mean relative cell proliferation, error bars depict±sd of four independent wells from a representative experiment (of three experiments). ( d ) Relative proliferation of MPDAC-4 cell line treated with CB-839 or DMSO with or without hydrogen peroxide (H 2 O 2 ) (20 μm). Data are plotted as mean relative cell proliferation, error bars depict±sd of three independent wells from a representative experiment (of three experiments). Arrow represents time point when treatments were refreshed. Significance determined by t -test in all panels. * P <0.05, ** P <0.01, *** P <0.001, ns: non-significant, P >0.05.

Imatge a mida completa

Image

( a ) Relative proliferation of MPDAC-4 cell line treated with CB-839 or DMSO with or without BSO (100 μm). Data are plotted as mean relative cell proliferation, error bars depict±sd of four independent wells from a representative experiment (of three experiments). Arrow represents time point when treatments were refreshed, similarly in c, e . ( b ) Relative proliferation of CB-839-resistant (CB-839-R) MPDAC-4 cell line treated with CB-839 alone or in combination with BSO (100 μm). Data are plotted as mean relative cell proliferation, error bars depict±sd of three independent wells from a representative experiment (of three experiments). ( c ) Relative proliferation of MPDAC-4 cell line treated with CB-839 or DMSO with or without methotrexate (MTX) (50 nm). Data are plotted as mean relative cell proliferation, error bars depict±sd of three independent wells from a representative experiment (of three experiments). ( d ) Relative proliferation of CB-839-R MPDAC-4 cell line treated with CB-839 alone or in combination with methotrexate (50 nm). Data are plotted as mean relative cell proliferation, error bars depict±sd of three independent wells from a representative experiment (of three experiments). ( e ) Relative proliferation of MPDAC-4 cell line treated with CB-839 or DMSO with or without etomoxir (100 μm). Data are plotted as mean relative cell proliferation, error bars depict±sd of three independent wells from a representative experiment (of three experiments). ( f ) Relative proliferation of CB-839-R MPDAC-4 cell line treated with CB-839 alone or in combination with etomoxir (100 μm). Data are plotted as mean relative cell proliferation, error bars depict±sd of three independent wells from a representative experiment (of three experiments). ( g ) MPDAC-4 cells were implanted subcutaneously in nude mice and after the average tumour size of the cohort reached ∼ 50 mm 3 mice were randomized and treated as indicated with vehicle, CB-839, BSO, or CB-839 and BSO, ( n =8 per arm), see methods for full details of dosing. Tumours were measured twice a week. Error bars represent±sem ( h ) Data as in ( g ) reproduced without CB-839 and BSO arms. Error bars represent±sem Significance determined by t -test in all panels. * P <0.05, ** P <0.01, *** P <0.001, ns: non-significant, P >0.05.

Imatge a mida completa

Given the marked increase in fatty acid oxidation-related metabolites and proteome changes suggestive of an increase in fatty acid metabolism in response to CB-839, we also tested the combination of CB-839 and etomoxir, a carnitine palmitotyltransferase I inhibitor that prevents shuttling of fatty acids to the mitochondria for oxidation 37 . Similar to BSO treatment, etomoxir had no effect as a single agent but decreased the regrowth of CB-839-treated cells when used concurrently (Fig. 7e). In contrast to BSO, etomoxir treatment in CB-839-R cells was ineffective, suggesting that the increased reliance on fatty acid metabolism was transitory during a shifting adaptive response (see below) (Fig. 7f).

Based on positive results of BSO combination with GLSi in vitro , we were interested if combinatorial targeting in vivo would prove useful. We therefore treated mice transplanted with MPDAC-4 cells with fully formed tumours with CB-839 with BSO. Strikingly, combination therapy resulted in significant tumour growth inhibition (Fig. 7g, h, P =0.008237, t -test). We also attempted a triple combination therapy with GLSi, BSO and etomoxir given positive results in cell culture; however, the dual combination of CB-839 and etomoxir was lethal in all mouse models tested (see methods). Taken together, these results indicate that rational combinatorial targeting of adaptive proliferation/metabolic pathways upregulated in response to GLSi can be an effective strategy for tumour control but that normal tissue toxicity must be carefully assessed as well.

GLSi network analysis identifies combinatorial treatments

The shift in sensitivity to fatty acid oxidation inhibitors suggested that in addition to proteomic evaluation at early time points in the acute response to GLSi, evaluating the proteomic response at long time points when cells have regained proliferative capacity could be informative. We therefore profiled MPDAC-4 and PaTu-8988T cells resistant to GLSi (Fig. 8a, Supplementary Data 6, 9). Quantitative proteomics of CB-839-R cells revealed a number of sustained proteomic changes including in oxidative stress response proteins (Supplementary Fig. 6a, Supplementary Data 7) as well as enzymes previously shown to be involved in Gln -deprivation cell survival stress response (ASNS and pyruvate carboxylase in MPDAC-4 cells) 31, 32, 38, 39 . Notably, enzymes related to fatty acid metabolism were no longer enriched, which aligns with a decreased sensitivity to etomoxir (Supplementary Fig. 6b, Supplementary Data 7). GSEA paired with enrichment map analysis revealed upregulated nodes for oxidative stress response, amino acid metabolism, lysosomal processes, glycolysis and pyruvate metabolism (Fig. 8b, Supplementary Data 10). Despite a return to baseline proliferation, downregulated nodes included mRNA metabolism, transcription, translation, as well as extracellular matrix regulation (Fig. 8b).

Image

( a ) Principal component analysis of the CB-839 treated proteomes represented in a two-dimensional space. ( b ) Enrichment map of GSEA of CB-839-R versus DMSO, FDR0.1, otherwise plotted as in Fig. 5d. ( c ) Enrichment map of GSEA of CB-839-R versus CB-839-72 h, FDR0.25. ( d ) Connectivity map (CMAP) workflow schematic for identification of candidate drugs for CB-839 synergy and pathway analysis. ( e ) CMAP analysis CB-839-24 h versus DMSO. Data represent mean connectivity score±sd as determined from CMAP analysis of Experiments 1–3 independently. ( f ) CMAP analysis CB-839-72 h versus DMSO as in ( e ). ( g ) CMAP analysis CB-839-R versus DMSO. Data represent mean connectivity score±sd from CMAP analysis of Experiment 4. ( h ) CMAP analysis CB-839-R versus CB-839-72 h as in g . ( i ) Relative proliferation of MPDAC-4 cell line treated with CB-839 or DMSO with or without 17-AAG (tanespimycin) (500 nm). ( j ) Relative proliferation of MPDAC-4 cell line treated with CB-839 or DMSO with or without albendazole (Prestwick-675) (400 nm). ( k ) Relative proliferation of MPDAC-4 cell line treated with CB-839 or DMSO with or without MG-132 (500 nm). Data for i, j, k are plotted as mean relative cell proliferation, error bars depict±sd of three independent wells from a representative experiment (of three experiments). For panels i, j, k, significance determined by t -test, * P <0.05, ** P <0.01, *** P <0.001, ns: non-significant, P >0.05.

Imatge a mida completa

We were also interested in examining the GSEA pattern comparing CB-839-72 h treated cells to CB-839-R cells to understand what processes active at 72 h may have reversed or were maintained. Many of the pathways enriched at 72 h in comparison with untreated cells (Fig. 5d), were downregulated in resistant cells in comparison with the 72 h time point, including fatty acid, amino acid, and pyruvate metabolism, lysosomal processes and the tricarboxylic acid cycle (Fig. 8c, Supplementary Data 10). Conversely, many of the processes downregulated at 72 h (Fig. 5d) were enriched in resistant cells in comparison with 72 h including DNA and RNA metabolism, transcription, translation and protein folding (Fig. 8c). Overall, this suggests that there was a return towards the basal/untreated state as reflected in the PCA analysis (Fig. 8a). However, as noted in Fig. 8b, several of the pathways downregulated in resistant cells in comparison with the CB-839-72 h time point, including pyruvate and amino acid metabolism as well as lysosomal processes, were still upregulated in comparison with untreated samples consistent with the PCA analysis that showed resistant cells were still distinct from untreated cells (Fig. 8a, b). As expected, nodes associated with oxidative stress response were not increased or decreased in resistant cells in comparison with 72 h treated cells and as in Fig. 8b, remained elevated in resistant cells in comparison with untreated cells. This aligns with our data showing continued sensitivity of CB-839-R cells to oxidant-inducing drugs and provides further support for combinatorial targeting.

To advance our understanding of the functional responses to GLSi and identify synergistic drug combinations not predicted by GSEA or on a protein-by-protein basis, we paired our proteomic analysis with the Connectivity Map 2.0 database 40, which contains expression profiles in response to 1309 different compounds (Fig. 8d). Here, we identified drugs with responses that were positively or negatively correlated with CB-839 treatment at 24 and 72 h as well as in CB-839-R cells (Fig. 8e–h, Supplementary Data 11). In the CB-839-24 h versus dimethylsulphoxide (DMSO) comparisons, drugs positively correlated with the observed proteomic response included thapsigargin and withaferin-A (endoplasmic reticulum (ER) stress inducers), gossypol (LDHA inhibitor which induces oxidative stress), 15Δ-prostaglandin J2 (PPARγ inducer, a regulator of lipid metabolism), Prestwick-675 (albendazole: microtubule polymerization inhibitor), thioridazine (anti-psychotic) and MG-262 (proteasome inhibitor). At 72 h positively correlated drugs included HDAC inhibitors (trichostatin, vorinostat), PI3-Kinase/mTOR inhibitors (LY-294002, wortmannin, quinostatin), alsterpaullone (CDK inhibitor), methotrexate and a topoisomerase inhibitor (camptothecin). Cyclosporine was positively correlated with changes in CB-839-R cells. Several of these classes of drugs have recently been shown to be associated with a synergistic response in combination with GLSi including HSP90 inhibition/ER stress activation and mTOR inhibition 41, 42 . Interestingly, the Connectivity Map analysis revealed pathways suggested by but not highlighted by GSEA, including an induction of the ER stress response (thapsigargin and withaferin-A). An induction of the ER stress response was confirmed by RT-qPCR analysis of CHOP, an ER stress-induced transcription factor, and BiP, an ER chaperone protein (Supplementary Fig. 6c). On further analysis of upregulated MPDAC-4 proteins at 72 h after CB-839 treatment, a majority of them have been previously reported to be induced under conditions of ER stress (VLDLR, PYCR1, CTH, PCK2, ALDH1L2, AVIL, LONP1, Supplementary Data 4). As in Fig. 8c, we were also interested if the Connectivity Map analysis could identify pathways that were no longer active in CB-839-R cells as opposed to acutely treated cells (CB-839-72 h). Connectivity Map analysis of CB-839-R versus CB-839-72 h changes (Fig. 8h) revealed that a number of drugs previously positively correlated with changes at 72 h (Fig. 8f), were inversely correlated including, PI3-Kinase/mTOR inhibitors (Wortmannin, Ly-294002, Sirolimus), MS-275 (HDAC inhibitor), and Tanespimycin (ER stress inducer). The reversal of the ER stress induction profile was recapitulated with RT-qPCR showing the CHOP and BiP levels in CB-839-R cells decreased from the peak CB-839-72 h values (Supplementary Fig. 6c).

To determine whether combination of GLSi and a select number of these drugs elicits a synergistic response, we tested several combinations in cell culture. Combination treatment with 17-AAG, albendazole and MG-132 elicited an additive response (Fig. 8i–k). As suggested by GSEA and Connectivity Map analysis, 17-AAG, albendazole and MG-132 were no longer as effective in CB-839-resistant cells (Supplementary Fig. 6d, e, f) highlighting the importance of timing of combination therapy administration.

Discussió

Our results reveal that PDAC cells have adaptive metabolic networks that allow them to utilize available nutrients to sustain proliferation. Using GLSi as an example, we show that although the in vitro effects on proliferation were quite marked, these were lost in multiple in vivo models of PDAC. Through an integrated analysis of proteomics and metabolomics, we identify multiple compensatory pathways that may explain the resistance to GLSi and show as proof of concept that combining inhibitors to these pathways with GLS inhibitors may have therapeutic utility. In addition to our study, several recent studies in PDAC as well as additional cancers have also identified combination therapies that target adaptive metabolic mechanisms of resistance or take advantage of adaptive responses to enhance therapy, albeit with less-comprehensive approaches 35, 43 .

The acute response to GLSi (Supplementary Fig. 7) is marked by induction of multiple stress response pathways including the ER stress response and anti-oxidant stress response. As a result of these and other responses, DNA synthesis, transcription, translation and protein folding are attenuated precipitating the observed decrease in proliferation. Another major area of acute adaptation is in re-wiring cellular metabolism. Alterations in metabolic enzymes, including increased expression of pyruvate carboxylase, can provide carbon to the tricarboxylic acid cycle via conversion of pyruvate to oxaloacetate and has been shown to be important for GLS-independent cell growth 38, 39 . Activation of lipid biosynthetic pathways, in part via PPARγ signaling, supports findings that Gln is an important source for accumulation of fatty acids and that alternative pathways are necessary in response to GLSi acutely 30 . Nucleotide biosynthesis reactions are affected by GLSi contributing to a decrease in DNA synthesis. Amino acid metabolism is likewise affected acutely by GLSi likely given a decrease in Glu available for transamination reactions. Finally, multiple enzymes capable of providing Glu via Gln-dependent and Gln-independent processes are upregulated all potentially contributing to replenishing Glu levels in MPDAC-4 cells. This final adaptation in the acute phase is likely responsible for MPDAC-4 cells regaining proliferation. However, PaTu-8988T cells never reestablish Glu levels yet are able to continue proliferation so they likely utilize alternative pathways that may not be Gln-dependent. CB-839-R cells maintain an elevated oxidative stress response, an increase in lysosomal processes, and upregulated glycolysis, nucleotide, sugar, amino acid and pyruvate metabolism. These resistant cells also appear to operate at a new basal level of ER stress and as such upregulate protein folding capacity to compensate for proteotoxic stress in comparison with acutely treated cells. It will be informative to compare proteomic responses across additional PDAC cell lines as well as additional GLSi-sensitive and insensitive cancers to understand what are the conserved proteomic responses that may direct combination therapy.

Several additional important findings emerged from our studies. First, how one performs the in vitro assessments of efficacy is extremely important. Standard 2 or 3-day growth assays may not be appropriate for inhibitors of cellular metabolism. Indeed, we noted upon longer term assays, that the cells began to regrow, which mirrored the lack of effect seen in the in vivo studies. Attempts at better modeling the in vivo growth conditions are warranted to faithfully model treatment responses in vitro . This includes more physiological media 44, oxygen tension 45 and potentially organoid growth conditions 46 .

Second, although we were unable to identify a specific cause of the CB-839-induced secondary tumour formation in our genetically engineered mouse model of PDAC, further investigation may reveal important metabolic factors in determining PDAC tumour initiation. We currently speculate that given the importance of redox homoeostasis/ROS in generation of tumours 11, 12, 47, that GLSi may cause a change in the redox environment of pre-invasive or early invasive oncogenic Kras expressing pancreatic cells in this model thereby promoting tumour initiation/progression. These hypotheses require additional testing, but the observed phenotypes are likely a consequence of the limitations of the genetically engineered PDAC mouse model.

Finally, integrating proteomic analyses with metabolomics can be extremely useful in determining which metabolic adaptations to GLSi might be critical to sustained growth. Determining metabolic fluxes in vivo is quite difficult and the presence of stroma will confound such analyses 10 . Because proteins are relatively stable, sorting or microdissection of the tumour cells is certainly feasible, whereas the labile nature of metabolic reactions likely precludes such manipulations. Therefore, a proteomics approach to determine the metabolic adaptations in a particular patient's tumour may allow for the tailoring of patient specific metabolic inhibitor cocktails. Our data, even in a limited number of PDAC lines, suggest that individual tumours may have unique kinetics or metabolic adaptations to the same metabolic perturbations. Protein expression is also readily adaptable to clinical scenarios, where if one could define metabolic biomarkers these could be assessed by immunohistochemistry (IHC) on tumour biopsies.

In conclusion, pancreatic cancers have striking metabolic plasticity. Carefully executed in vitro analyses can help understand the metabolic adaptations to metabolic perturbations. By understanding the modalities of adaptation, we can develop novel and more effective therapeutic targets. Indeed, our analyses yielded several interesting combinatorial approaches that showed efficacy. Although combination metabolic inhibition may be a promising strategy, identifying whether these same synergies exist in normal tissues will be critical to ensure a therapeutic index. Further studies into the mechanisms of resistance and metabolic adaptation will help create more promising therapeutic options.

Mètodes

Cultiu cel·lular

IMR90, PANC-1 and BxPC-3 cell lines were obtained from the American Type Culture Collection. PaTu-8988t and PaTu-8902 that were obtained from the German Collection of Microorganisms and Cell Cultures. Primary mouse PDAC lines (MPDAC-1 and MPDAC-4) were generated from tumours from genetically engineered mice (LSL-Kras G12D ; p53 L/+, Pdx1-Cre) 24, mouse embryonic fibroblasts were generated from a LSL-Kras G12D ; p53 L/+ mouse. Cell lines were authenticated by fingerprinting as well as visual inspection and carefully maintained in a centralized cell bank. All cell lines were tested routinely, and before all metabolomics and proteomic analyses, for mycoplasma contamination. Cell lines were cultured in DMEM (Invitrogen 11965) with 10% fetal bovine serum (FBS) and 1% Penicillin/Streptomycin except for Supplementary Fig. 1i where cells were cultured in RPMI-1640 (Invitrogen 11875) supplemented with 10% FBS and 1% penicillin/streptomycin and in Supplementary Fig. 1j where cells were grown on ultra-low attachment plates (Sigma, CLS7007) in 2% growth factor reduced matrigel (BD, 354230) supplemented with DMEM with 10% FBS and 1% penicillin/streptomycin.

Assaig de proliferació cel·lular

Cells were plated in 24-well plates at 2, 000–7, 000 cells (depending on cell line) per well in 0.5 ml of media. The day after plating, cells were treated with CB-839 (100 nm unless otherwise indicated). For long-term assays (>5 days), drugs were refreshed at the mid-point of the experiment. At the indicated time points, cells were fixed in 10% formalin and stained with 0.1% crystal violet. Dye was extracted with 10% acetic acid and the relative proliferation was determined by OD at 595 nm.

Anàlisi IC50

Cells were plated in 96-well plates and treated by serial dilution of CB-839 the day after plating for 48–72 h. Cell viability was measured using the CellTiter-Glo assay (Promega, G7570) according to the manufacturer's instructions. The IC50 was calculated using Graphpad Prism using three-parameter nonlinear regression analysis.

Trypan assay

Cells were treated in biological triplicate with DMSO or the indicated concentrations of drug including Staurosporine (Sigma, S5921). After 72 h, percent survival was assessed using a trypan blue exclusion assay.

Mouse treatment studies and ultrasound

Cohorts of genetically engineered mice were generated from a single colony (LSL-Kras G12D ; p53 L/+; Pdx1-Cre) under DFCI IACUC protocol 10-055. Beginning at 8 weeks of age, mice were monitored for tumour formation via abdominal palpation 26 . Tumour identification was confirmed and dimensions and volume were measured using high-resolution ultrasound (Vevo 770). In brief, mice were anesthetized using 1.5% isoflurane, abdominal fur was removed using fine clippers and depilatory cream. Pre-warmed sterile saline (1–2 ml) was administered via intraperitoneal (IP) injection. Ultrasound gel was applied over the entire abdominal area and the ultrasound transducer was used to identify abdominal landmark organs (liver/spleen) followed by the pancreas and the tumour. Once identified, the transducer was transferred to the 3D motor stage and a 3D scan was performed for measurement of tumour dimensions and volume. Tumour volumes were contoured for serial volumetric measurements 26 . For treatment studies, mice with tumours in the 50–100 mm 3 size range were enroled in a randomized fashion to either vehicle or CB-839 (vehicle, n =11, CB-839, n =13, average age: 24 weeks, mixed male and female, LSL-Kras G12D ; p53 L/+; Pdx1-Cre, mixed background (FVB and C57-Bl/6j)). Enrollment on the trial was balanced between arms in terms of starting tumour size, location of tumour within the pancreas, age of mice, and female versus male distribution. The vehicle consisted of 25% (weight/volume) hydroxypropyl-β-cyclodextrin (Roquette) in 10 mmol/l citrate, pH 2. CB-839 was formulated as a solution at 20 mg ml −1 (w/v) in vehicle. Mice were dosed twice daily via oral gavage with 200 mg kg -1 CB-839 or vehicle 15 . Daily treatment was continued until end point criteria were met. End point criteria included the development of haemorrhagic abdominal ascites, severe cachexia, weight loss exceeding 15% of initial weight, or extreme weakness or inactivity, in accordance with DFCI 10-055 IACUC approved protocol. Kaplan–Meier curves were plotted for survival studies and a log-rank test was used to compare the differences in survival probabilities. For pharmacokinetic and pharmacodynamics studies, mice were dosed and tumours and plasma were harvested at time points as specified. For orthotopic tumours 1 × 10 4 MPDAC-4 cells expressing luciferase were implanted into the tail of the pancreas of 8-week-old female NCr nude mice (Taconic) in 1:1 Matrigel (vehicle, n =13, CB-839, n =16). Mice were randomized to receive CB-839 or vehicle daily (as above), beginning 7 days after injection and luciferase imaging was performed weekly at the DFCI Small Animal Imaging Facility. Tumours were weighed at time of sacrifice. For subcutaneous xenografts, MPDAC-4 (1 × 10 6 ) or PATU-8988T (5 × 10 6 cells) cells, suspended in matrigel were injected subcutaneously into the lower flank of 8-week-old female NCr nude mice (Taconic) (MPDAC-4, vehicle, n =14, CB-839, n =13) (PaTu-8988T, vehicle, n =9, CB-839, n =8). Mice were randomized to receive CB-839 or vehicle daily when the average tumour volume was 50 mm 3 . Tumour length and width were measured weekly and the volume was calculated according to the formula: V =(width 2 × length)/2. For combination studies with BSO, MPDAC-4 subcutaneous xenografts were generated as above in 8-week-old female NCr nude mice and were randomized to one of four treatment arms: (1) Vehicle oral gavage twice daily/Normal saline IP injection once daily, (2) CB-839 200 mg kg −1 oral gavage twice daily/normal saline IP injection once daily, (3) Vehicle oral gavage twice daily/BSO 400 mg kg −1 once daily and (4) CB-839 200 mg kg −1 oral gavage twice daily/BSO 400 mg kg −1 once daily ( n =8 mice per arm). For triple combination trials with CB-839, BSO and etomoxir, mice were first dosed with etomoxir and CB-839 to establish a dosing safety profile. Although CB-839 treated mice displayed no overt toxicity, CB-839 and etomoxir-treated mice in a pilot dose study (at doses of etomoxir from 60 mg kg −1 to 40 mg kg −1 including both NCr nude mice and genetically engineered mice on a mixed background) became acutely ill within hours post-dosing with severe lethargy and signs of hypoperfusion with symptoms meeting end point criteria requiring euthanasia. On pathologic examination, no definitive cause of death could be ascertained. Further attempts at CB-839 and etomoxir combination treatment beyond these pilot dosing trials were not pursued. All mouse experiments were conducted in compliance with ethical regulations approved by the DFCI Institutional Animal Care and Use Committee (IACUC) under protocol number 10-055.

Anàlisi de taquilla occidental

After SDS–PAGE, proteins were transferred to Hybond-N Nitrocellulose (Amersham Biosciences, 45-001-227). Membranes were blocked in Tris-buffered saline (TBS) containing 5% non-fat dry milk and 0.1% Tween 20 (TBS-T), before incubation with the primary antibody overnight at 4 °C. The membranes were then washed with TBS-T followed by exposure to the appropriate horseradish peroxidase-conjugated secondary antibody (1:10, 000) for 1 h and visualized on Kodak X-ray film using the enhanced chemiluminescence detection system (Thermo Scientific, PI80196). The following antibodies were used: GLS (Abcam, ab93434, 1:1, 000), β-actin (Sigma, A5441, 1:5, 000), Cleaved Caspase-3 (Cell Signaling, 9661, 1:1, 000), ALDH1L2 (LifeSpan Biosciences, LS-C178510, 1:100), CTH (Santa Cruz Biotechnology, sc-374249, 1:100) and VCL (Millipore, AB6039, 1:5, 000).

Metabolite and CB-839 measurements

Steady state metabolomics experiments were performed as previously described 9, 15 . In brief, PDAC cell lines were grown to ∼ 80% confluence in growth media with CB-839 or DMSO for the indicated time points (DMEM, 4 mM Gln, 25 mM Gluc, 10% dialysed FBS) on 6 cm dishes in biological triplicate. A complete media exchange with indicated drug was done 4 h before collection. Metabolomics and CB-839 experiments in Figs 2a, c and 3e, Supplementary Fig. 2i, and 3i were performed as described 15 . In brief, cell lines or mouse tissues were homogenized in methanol:water (80:20) containing 10 mmol l -1 13 C5, 15 N-Glu as the internal standard and analysed for metabolite levels by liquid chromatography-tandem mass spectrometry (LC/MS-MS) using the SCIEX API4000 (Applied Biosystems). Mouse tissue homogenates were also analysed for CB-839 levels using a similar method except that 50 nmol l −1 carbamazepine was used as the internal standard. Metabolomics experiments in Figs 1h and 4b, c, e, f, Supplementary Fig. 1k, 3h, and Supplementary Data 1 were performed using LC/MS analysis 48 . In brief, LC/MS analyses were conducted on a QExactive benchtop orbitrap mass spectrometer equipped with an Ion Max source and a HESI II probe, which was coupled to a Dionex UltiMate 3000 UPLC system (Thermo Fisher Scientific, San Jose, CA, USA). External mass calibration was performed using the standard calibration mixture every 7 days. Polar metabolites were extracted from cells or tissues using 1 ml of ice-cold 80% methanol with 10 ng ml −1 valine-d 8 (Cambridge Isoptope Laboratories DLM-488-PK) AND 10 ng ml −1 of Phenylalanine-d 5 (Cambridge Isoptope Laboratories DLM-1258-5) as internal standards. After a 10 min vortex and centrifugation for 10 min at 4 °C at 10, 000 g , samples were dried using a speed vacuum. Dried samples were stored at −80 °C and then resuspended in 100 μl water; 1 μl of each sample was injected onto a ZIC-pHILIC 2.1 × 150 mm (5 μm particle size) column (EMD Millipore). The mass spectrometer was operated in full-scan, polarity switching mode. Relative quantitation of polar metabolites was performed with XCalibur QuanBrowser 2.2 (Thermo Fisher Scientific) using a 5 ppm mass tolerance and referencing an in-house library of chemical standards. The quantity of the metabolite fraction analysed was adjusted to the corresponding protein concentration and cell count calculated upon processing a parallel 6 cm dish. To trace Gln metabolism (Supplementary Fig. 3e, f, Supplementary Data 3), PDAC cell lines were grown as above with the indicated treatments and then transferred into Gln-free DMEM (with 25 mM glucose) containing 10% dialysed FBS and 4 mM [U- 13 C 5 ]Gln (Cambridge Isotope Labs) at the indicated time points in the flux analyses.

GLS assay activity

GLS activity was measured in homogenates prepared from tumours using a coupled biochemical assay monitoring Glu production with the NADPH-dependent enzyme Glu dehydrogenase as described previously 15 .

Immunohistoquímica

Tissues were fixed in 10% formalin overnight and embedded in paraffin. Hematoxylin and eosin and immunohistochemical analysis was performed as described 49 . In brief, slides were deparaffinized in xylene and rehydrated sequentially in ethanol. For antibodies requiring antigen retrieval, slides were incubated in a pressure cooker in sodium citrate buffer for 15 min. Slides were then quenched in hydrogen peroxide (0.3–3%) to block endogenous peroxidase activity and then washed in phosphate-buffered saline (PBS). Slides were blocked in normal serum for 1 h at room temperature. Primary antibody was applied either overnight at 4 °C or for 1 h at room temperature then developed using vectastain Elite ABC kit (Vector labs PK-6100) or Elite MOM kit (Vector Labs PK-2200) and DAB (Vector labs SK-4100). Slides were counterstained with hematoxylin (Vector Labs H-3401) and then dehydrated sequentially in ethanol, cleared with xylenes, and mounted with Permount (Fisher). The antibodies and dilutions were as follows: SMA (Dako, M0851) 1:500, Ki67 (Ventana Medical Systems, 790-4286) 1:100. For differentiation status studies, Hematoxylin and eosin-stained slides were scored in a blinded manner. Differentiation was categorized throughout the entire tumour in eight equal fields as well, moderately, poorly or undifferentiated based on a combination of ductal architecture or lack thereof, level of pleomorphic nuclei and number of mitoses. For quantification of IHC staining of tumours, SMA was quantified using 10, 20 × fields from each tumour. The percent area of SMA was calculated using ImageJ 50 to highlight the positively stained regions and averaged for each tumour. Likewise, Ki-67 percentage was calculated from 5, 40 × fields in each tumour by counting the ratio of positively stained nuclei to negatively stained nuclei.

Quantitative proteomics

Quantitative mass spectrometry-based proteomics were performed as previously described 51 . TMT isobaric reagents were from Thermo Scientific (Rockford, IL, USA). Water and organic solvents were from JT Baker (Center Valley, PA, USA). Cells were homogenized by 20 passes through a 21 gauge (1.25 in. long) needle in lysis buffer (8 M Urea, 200 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) pH 8.5, 1 × Roche protease inhibitors, 1 × Roche PhosphoStop phosphatase inhibitors) at a protein concentration of ∼ 5 mg ml −1 . The homogenate was sedimented by centrifugation at 20, 000 × g for 5 min at 4 °C. Proteins were subjected to disulfide bond reduction with 5 mM dithiotreitol (37 °C, 25 min) and alkylation with 10 mM iodoacetamide (room temperature, 30 min in the dark). Excess iodoacetamide was quenched with 15 mM dithiotreitol (room temperature, 15 min in the dark).

Chloroform–methanol precipitation of proteins from cells was performed prior to protease digestion. In brief, four parts neat methanol was added to each sample and vortexed, one part chloroform was added to the sample and vortexed and three parts water was added to the sample and vortexed. The sample was centrifuged at 10, 000 rpm for 2 min at room temperature and subsequently washed twice with 100% methanol. Samples were resuspended in 200 mM HEPES pH 8.5 for digestion. Protein concentrations were determined using the bicinchoninic acid assay.

For each of the samples, 100 μg of protein was digested at 37 °C for 3 h with LysC protease at a 1:100 protease-to-protein ratio. Trypsin was then added at a 1:100 protease-to-protein ratio and incubated overnight at 37 °C. Approximately 50 μg of peptides from each sample were labelled with TMT reagent (100 μg). For cell line analysis, three biological replicates were labelled per time point as indicated.

TMT reagents (0.8 mg) were dissolved in anhydrous ACN (40 μl) of which 10 μl was added to the peptides (resuspended in 70 μl of 100 mM HEPES, pH 8.5) along with 20 μl of ACN to achieve a final ACN concentration of 30% v/v. Following incubation at room temperature for 1 h, the reaction was quenched with hydroxylamine to a final concentration of 0.3% v/v. The TMT-labelled samples were combined at a 1:1:1:1:1:1:1:1:1:1 ratio. The sample was acidified, vacuum centrifuged to near dryness and subjected to C18 SPE (Sep-Pak, Waters). Samples were separated using basic pH reversed-phase HPLC for protein-level analyses and then pooled into 12 fractions.

Data were collected using an Orbitrap Fusion mass spectrometer (Thermo Fisher Scientific) coupled with a Proxeon EASY-nLC 1000 LC pump (Thermo Fisher Scientific). Peptides were separated on a 100 μm inner diameter microcapillary column packed with 0.5 cm of Magic C4 resin (5 μm, 100 Å, Michrom Bioresources) followed by 35 cm of Accucore C18 resin (2.6 μm, 100 Å, ThermoFisher Scientific).

Peptides were separated using a 3 h gradient of 6–30% ACN in 0.125% formic acid with a flow rate of 300 nl min −1 . Each analysis used an MS 3 -based TMT method as described previously 27 . Mass spectra were processed using a Sequest-based in-house software pipeline as described previously 51 . Protein quantitation values were exported for further analysis. Each reporter ion channel was summed across all quantified proteins and normalized assuming equal protein loading of all nine samples.

Anàlisi de la bioinformàtica

For visualisation of the proteomic data sets, volcano plots were created showing log 2 of relative abundance of proteins in the compared groups and corresponding P values transformed into −log 10 values. Top or bottom 5% regulated proteins were denoted in Fig. 5a, b to highlight greater variance in CB-839-72 h versus CB-839-24 h data sets. All proteins with at least two peptides identified were subjected to one-way analysis of variance (one-way ANOVA) with a Bonferroni-adjusted P value to filter for proteins that were significantly changed. Calculations were performed on log10-transformed values. Post hoc tests (Bonferroni-adjusted t -test) were used to identify proteins with significant pairwise differences. Principal component analysis of proteins that showed significant differences in ANOVA was used to visualize the data set in a two-dimensional coordinate space. In addition, as the proteomic analysis could be considered a hypothesis-generating step for further validation experiments, false discovery rates (FDRs) were calculated both for ANOVA P values using the Benjamini–Hochberg procedure with pairwise tests performed for significant ( P <0.05, FDR<0.05) peptides. Gene set enrichment analyses 52 was performed for proteomic data. For this analysis proteins were included where at least two peptides were detected and protein names were translated to gene names with Biomart 53 . This analysis searches for the locations of proteins associated with a given biological function or pathway within the ranked list of all proteins present in the data set and calculates an enrichment score depending on the set being globally up- or downregulated. GSEA has been successfully used for proteomic data 28 and its reliance on validated and curated biological pathways made it a good tool for identifying processes dysregulated by CB-839 treatment and ones associated with resistance. A false discovery rate is calculated to account for the number of comparisons made. The canonical pathways MSigDB category (c2.cp.v5.2.symbols.gmt) was used for GSEA 52 . Gene sets enrichment results for CB-839 72 h versus DMSO analysis (from Experiment 1) are represented in Supplementary Data 5. The DMSO versus CB-839 72 h versus CB-839-R data sets were analysed with one additional comparison for gene set analysis (DMSO versus CB-839 72 h, DMSO versus CB-839-R and CB-839 72 h versus CB-839-R) (lists are tabulated in Supplementary Data 10). Enrichment maps 29 were constructed for gene sets that differed significantly with a FDR 0.25 for comparison of CB-839 treated MPDAC-4 cells for 72 h and untreated cells (Fig. 5d) and CB-839-R cells versus CB-839 treated cells for 72 h (Fig. 8c). For comparison of CB-839-R cells versus untreated cells we used a cutoff value for FDR0.1 owing to lower variability of these data sets (Fig. 8b). For Connectivity Map 2.0 (Cmap 2.0) analysis proteins that were up- (fold change (FC) >1.5) or downregulated (FC<0.67) in two comparisons: CB-839 24 h versus DMSO and CB-839 72 h versus DMSO were evaluated. The Connectivity Map 2.0 (Cmap 2.0) analysis platform correlates the observed pathway dysregulation with known effects of experimentally tested drugs on multiple cell lines 40 . As this was an exploratory analysis, FDR values calculated as above were disregarded. Furthermore for the MPDAC-4 DMSO versus CB-839 24 h and CB-839 72 h, all three available data sets were analysed separately and drugs displayed in Fig. 8e, f were identified in all three data sets. As only one data set was available for the MPDAC-4 DMSO versus CB-839 72 h and CB-839-R, only proteins with adjusted FDR1.5, FC<0.67 (according to protocol selection shown in Fig. 8d) were analysed using Cmap 2.0 (Supplementary Data 11). Metaboanalyst was used to analyze proteomic data in combination with metabolomics data where indicated(Supplementary Data 8) 34 .

Lentiviral-mediated shRNA targets

shRNA vectors were obtained from the RNA Interference Screening Facility of Dana Farber Cancer Institute or Addgene, sequences as follows: shGLS-1, GCACAGACATGGTTGGTATAT (TRCN0000051135); shGLS-2, GCCCTGAAGCAGTTCGAAATA (TRCN0000051136). shGFP: 5′-GCAAGCTGACCCTGAAGTTCAT-3′ (Addgene plasmid #30323).

Productes químics

U13C labelled L -Gln (Cambridge Isotope Laboratories CLM-1822-H-0.1), L -Gln (Sigma, G3126), Glu (Sigma, G1626). CB-839 (Calithera Biosciences), BSO (Cayman Chemical, #14484), Methotrexate (Sigma, #A6770), Albendazole (Sigma, #A0325100), 17-AAG (Sigma, #A8476), Etomoxir (Cayman Chemical, #11969), BPTES (Sigma, #SML0601), MG-132 (Sigma, SML1135).

Citometria de flux

CellRox assay was performed at indicated time points after CB-839 treatment. Cells were incubated with 5 μM CellRox Reagent (Life Technologies, C10444) for 30 min. Excess CellRox was removed by washing the cells with PBS, and labelled cells were then trypsinized, rinsed, resuspended in PBS and analysed by flow cytometry.

GSH assay

Total GSH and GSH/GSSG ratios were measured after treatment with CB-839 according to the manufacturer instructions (Promega, V6611). Data was normalized to additional wells that received identical conditions using CellTiter Glo (Promega, G7570).

PCR quantitativa

Total RNA was extracted using RNeasy RNA isolation kit (Qiagen, 74104) according to the manufacturer's instructions. Reverse transcription was performed from 2 μg of total RNA using SuperScript Vilo IV cDNA synthesis kit (Thermo Fisher, 11756050), according to the manufacturer's instructions. Quantitative RT–PCR was performed with SYBR Green dye (BioRad, 1725271) using a CFX96 Real Time System (BioRad, 1855195). PCR reactions were performed in triplicate and the relative amount of cDNA was calculated by the comparative CT method using the 18S ribosomal RNA sequences as a control.

Seqüències primeres

Sequences for qPCR primers are as follows (all murine): E-Cadherin(F): CTCCAGTCATAGGGAGCTGTC, E-Cadherin(R): TCTTCTGAGACCTGGGTACAC, N-Cadherin(F): AGGCTTCTGGTGAAATTGCAT, N-Cadherin(R): GTCCACCTTGAAATCTGCTGG, Snail(F): CACACGCTGCCTTGTGTCT, Snail(R): GGTCAGCAAAAGCACGGTT, Twist(F): GGACAAGCTGAGCAAGATTC, Twist(R): CGGAGAAGGCGTAGCTGAG, Vimentin(F): TCCACACGCACCTACAGTCT, Vimentin(R): CCGAGGACCGGGTCACATA, CHOP(F): AAGCCTGGTATGAGGATCTGC, CHOP(R): TTCCTGGGGATGAGATATAGGTG, BiP(F): ACTTGGGGACCACCTATTCCT, BiP(R): GTTGCCCTGATCGTTGGCTA, 18S(F): GTAACCCGTTGAACCCCATT, 18S(R): CCATCCAATCGGTAGTAGCG.

Anàlisi estadística

For all data aside from proteomics data, statistical analysis was done using GraphPad PRISM and Excel software. No es van utilitzar mètodes estadístics per predeterminar la mida de la mostra. Survival curve statistical analysis was performed using the log-rank (Mantel–Cox) test. When comparing continuous variables between two groups to each other, a Student's t -test (unpaired, two-tailed) was performed. For Supplementary Fig. 2a, b, the frequency of secondary tumour development and metastases development was compared using a two-tailed Fisher's exact test. A type 1 error probability <0.05 was considered as the threshold for statistical significance, with adjustments made for multiple hypothesis testing where necessary, as described in the bioinformatics section above. Proteomic data statistical values presented in Supplementary Data 4, 6, 9. Remainder of statistical values presented in Supplementary Data 12.

Disponibilitat de dades

The quantitative mass spectrometry-based proteomics RAW data files have been deposited in the Peptide Atlas database under the accession code PASS00985. The processed proteomics data are available in the Supplementary Information. The authors declare that all the other data supporting the findings of this study are available within the article and its Supplementary Information files and from the corresponding author upon reasonable request.

Informació complementària

Fitxers PDF

  1. 1.

    Informació complementària

  2. 2

    Fitxer de revisió entre pares

Fitxers Excel

  1. 1.

    Dades complementàries 1

  2. 2

    Dades complementàries 2

  3. 3.

    Dades complementàries 3

  4. 4.

    Dades complementàries 4

  5. 5.

    Dades complementàries 5

  6. 6.

    Dades complementàries 6

  7. 7.

    Dades complementàries 7

  8. 8.

    Dades complementàries 8

  9. 9.

    Dades complementàries 9

  10. 10.

    Supplementary Data 10

  11. 11.

    Supplementary Data 11

  12. 12.

    Supplementary Data 12

Comentaris

En enviar un comentari, accepteu complir els nostres Termes i Directrius de la Comunitat. Si trobeu alguna cosa abusiva o que no compleix els nostres termes o directrius, marqueu-la com a inadequada.