Mycobacteriophage swu1 gp39 pot potenciar múltiples antibiòtics contra el micobacteri mitjançant l’alteració de la permeabilitat de la paret cel·lular | informes científics

Mycobacteriophage swu1 gp39 pot potenciar múltiples antibiòtics contra el micobacteri mitjançant l’alteració de la permeabilitat de la paret cel·lular | informes científics

Anonim

Temes

  • Antibiòtics
  • Microbiologia aplicada

Resum

La M. tuberculosis és intrínsecament tolerant a molts antibiòtics degut en gran mesura a la impermeabilitat de la seva inusual paret cel·lular que conté àcid micòlic a la majoria dels antimicrobians. El sorgiment i la difusió de la tuberculosi multirresistent (MDR-TB) i la tuberculosi (XDR-TB) amb gran resistència als fàrmacs van revitalitzar el gran interès per la teràpia inspirada en el fag. SWU1gp39 és un gen nou del micobacteriòfag SWU1 amb funció desconeguda. SWU1gp39 expressada en M. smegmatis va proporcionar a la cèl·lula hoste una major susceptibilitat a múltiples antibiòtics, incloent isoniazida, eritromicina, norfloxacina, ampicilina, ciprofloxacina, ofloxacina, rifampicina i vancomicina i múltiples estrès ambientals com H 2 O 2, xoc de calor, baix pH i SDS Mitjançant assajos de captació vermella EtBr / Nil, la soca WT-pAL-gp39 va mostrar una permeabilitat a la paret cel·lular superior a la soca de control WT-pAL. D'altra banda, la soca WT-pAL-gp39 va produir espècies d'oxigen més reactives i va reduir la proporció NAD + / NADH. Els transcriptomes RNA-Seq del WT-pAL-gp39 i WT-pAL van revelar que la transcripció de 867 gens estava regulada diferencialment, incloent gens associats al metabolisme dels lípids. En conjunt, els nostres resultats van implicar que SWU1gp39, un nou gen de micobacteriòfag, va alterar el metabolisme dels lípids de l’hoste i va augmentar la permeabilitat de la paret cel·lular, en última instància va potenciar l’eficàcia de múltiples antibiòtics i les tensions contra els micobacteris.

Introducció

La tuberculosi, causada per Mycobacterium tuberculosis ( M. tuberculosis ), segueix sent una preocupació important per a la salut pública mundial. L'aparició de soques de M. tuberculosi (MDR-MTB) resistents a diversos medicaments i de M. tuberculosi (XDR-MTB) resistents als fàrmacs van agreujar la situació. La M. tuberculosis és intrínsecament tolerant a molts antibiòtics degut en gran mesura a la impermeabilitat de la seva paret cel·lular que conté àcid micòlic inusual a la majoria de quimioterapéutiques i expressió inductible de diverses bombes d’eflux de fàrmacs actives. Es van identificar alguns gens implicats en el metabolisme o en altres processos per mediar la resistència intrínseca en les micobacteries. La inactivació de l’asparagina sintetasa AsnB, un enzim biosintètic d’asparagina que catalitza la transferència del residu γ-amino de la glutamina al residu carboxil de l’aspartat, sensibilitzat dramàticament Mycobacterium smegmatis ( M. smegmatis ) a múltiples antibiòtics, incloent rifampina, eritromicina àcid 1 Els micobacteris proteasomes accessory facror ( pafC ), un component del proteasoma bacterià, es van identificar per estar implicats en la resistència intrínseca als fluoroquinolones. Els mutants d’inactivació del PafC són específicament hipersensibles a les fluoroquinolones, incloent la moxifloxacina, la norfloxacina, l’ofloxacina, la ciprofloxacina, però no a altres antibiòtics com l’isoniazida, la rifampicina, l’espectinomicina, la cloramfenicol, la capreomicina 2 . La proteïna quinasa G (pknG), la proteïna cinasa serina / treonina, també va ser necessària per a la resistència intrínseca als antibiòtics a les micobacteries 3 . A M. smegmatis , una altra proteïna cinasa serina / treonina MSMEG_5437 i un factor anti-sigma predicat MSMEG_6129 van participar en la resistència intrínseca a diverses tensions incloent l'agent genotòxic mitomicina C, el peròxid d'hidrogen i almenys quatre antibiòtics diferents, a saber, isoniazid, cloramfenicol., eritromicina i tetraciclina 4 . L'isocitrat liases (ICLs), enzims metabòlics prèviament reconeguts com dedicats a la reposició dels intermedis del cicle d'àcid tricarboxílic (TCA), recentment s'ha demostrat tenir un paper inesperat en la defensa de l'antioxidant com a mecanisme de tolerància als antibiòtics 5 . Es va trobar que el citocrom bd va jugar un paper clau en la supervivència dels micobacteris durant l'estrès letal múltiple, inclòs el peròxid d'hidrogen, clofazimina i bedaquilina 6, 7 . La resistència intrínseca als micobacteris als fàrmacs representa un formidable obstacle per al control de la tuberculosi. És imprescindible trobar nous objectius terapèutics o sinergètics que puguin potenciar la letalitat antimicrobiana contra la tuberculosi.

Malgrat l’àcid micòlic altament impermeable que conté la paret cel·lular, diversos fàrmacs anti-tuberculosi de primera o segona línia dirigits a la paret cel·lular estan en ús clínic, com l’Isoniazid (INH) que pot alterar la integritat de la paret cel·lular inhibint la biosíntesi de l’àcid micòlic 8 . A l'entrada de M.tuberculosis , el prodrug INH s'activa per formar un radical lliure d'isonicotinil mitjançant la peroxidasa bacteriana / catalasa katG 9 . El radical lliure d’INH reacciona amb NAD per formar un complex INH-NAD que és un potent inhibidor de l’enzim essencial InhA, una enoyl-ACP reductasa necessària per a la biosíntesi d’àcid micòlic 10, 11 . Múltiples factors que contribueixen aïllats clínics La resistència a l’INH van limitar l’eficàcia de l’INH 12, 13 . L’etionamida, un analògic estructural d’INH, és un altre fàrmac anti-TB que inhibeix l’activitat d’InhA mitjançant un mecanisme d’acció similar al d’INH però requereix l’activació per EthA en lloc de katG 10 . Les mutacions del gen estructural o promotor inhA apuntalen la resistència a ETH. Altres factors com ara alteracions de l’expressió dels activadors de fàrmacs, canvi d’estat redox, inactivació de fàrmacs i activació de la bomba d’eflux 14, contribueixen a la resistència a l’INH i l’ETH. Per combatre la tuberculosi es necessiten nous fàrmacs anti-TB dirigits a la paret cel·lular.

El bacteriòfag, el virus dels bacteris, és una eina útil per controlar les infeccions de bacteris. Les endolisines són peptidoglicans hidrolases codificades per bacteriòfags que poden descompondre el peptidoglicà bactèric a l'estadi terminal del cicle de reproducció del fagi 15 . Les endolisines són a prova com a agents antimicrobians potencials, especialment per a bacteris resistents a multidrogues. Abp1, un fag virulent dirigit al Acinetobacter baumannii resistent a diversos medicaments, que codifica una endolysina PlyAB1 va mostrar una activitat antibacteriana significativa contra els 48 aïllats clínics de PDRAB en un termini de temps relativament curt 16 . Moltes endolysines derivades de micobacteriòfags han mostrat activitat antimicobacteriana, incloent el micobacteriòfag Bxz2 17, BTCU-1 18, Ms6 19, 20, D29 21 . Les endolysines lítiques es persegueixen intensament com a agents de sanejament o desinfectants alternatius contra les infeccions per micobacteri. Amb una estimada enorme biomassa de 10 31 fagos a tot el món, les endolysines codificades per fags i altres proteïnes efectives representen un vast dipòsit per als antimicrobians nous. La proteïna Ref codificada per bacteriòfags P1, una nova classe d'endonucleasa, és tòxica específicament durant la resposta SOS bacteriana o els cultius de fase estacionària 22 . Aquests estudis impliquen que la teràpia basada en fagis pot ser alternativa o complementar als antibiòtics.

En aquest estudi, vam identificar un nou gen gp39 del micobacteriòfag SWU1, que no hi havia en el micobacteriòfag L5, tot i que els SWU1 i L5 són molt similars. Es va expressar SWU1gp39 a M. smegmatis mitjançant vector pALACE sota el control d'un promotor inductible amb acetamida. La soca recombinant (WT-pAL-gp39, induïda per acetamida) va mostrar una deficiència de creixement en un medi que conté higromicina en comparació amb la soca de control (WT-pAL), tot i que pALACE conté un casset de resistència a la higromicina. La SWU1gp39 expressada en M. smegmatis condueix a una major susceptibilitat a múltiples antibiòtics, incloent isoniazida, eritromicina, norfloxacina, ampicilina, ciprofloxacina, ofloxacina, rifampicina i vancomicina, també algunes tensions ambientals com H 2 O 2, SDS, pH baix i xocs de calor. Utilitzant RNA-seq, vam trobar que les vies reguladores i metabòliques es van canviar per SWU1gp39. La microscòpia electrònica d’escaneig (SEM) i els assajos de bromur d’etidium o d’absorció vermella del nil van mostrar la morfologia i l’alteració de la permeabilitat de la paret cel·lular en la soca recombinant.

Resultats

Gp39 és un gen nou de Mycobacteriophage SWU1

Mycobacteriophage SWU1 és un fag recentment aïllat de les mostres de sòl recollides a la província de Sichuan, Xina 23, molt similar al micobacteriòfag L5 24, però no es va trobar cap homòleg de SWU1gp39 al genoma L5 (Fig. 1A). No es va trobar cap homòleg a NCBI utilitzant BLAST fins que el micobacteriòfag EagleEye i Serenity es van aïllar (Fig. 1B). Per definir la funció de SWU1gp39, es va amplificar a partir del genoma SWU1 (Fig. 1C) i es va expressar una proteïna gp39 marcada amb His mitjançant un plasmidi pALACE recombinant (Fig. 1D).

Image

( A ) Comparació de l'organització del genoma gp39 locus en SWU1 i espècies relacionades L5. L’ombrejament gris representa una regió de conservació entre els genomes. ( B ) Alineació de la seqüència d'aminoàcids (generada mitjançant DNAMAN) de gp39 en SWU1 i parent proper. ( C ) Amplificació per PCR de la seqüència de codificació de gp39 aproximadament de 240 pb. El gen SWU1gp39 ( D ) i els seus gens homòlegs de Serenity o EagleEye ( E ) van ser expressats en M. smegmatis i detectats mitjançant Western blot.

Imatge a mida completa

L’expressió SWU1gp39 afecta el creixement de l’hoste després de l’exposició a diversos antibiòtics

Per provar l'efecte de SWU1gp39 en soques recombinants, les taxes de creixement de WT-pAL i WT-pAL-gp39 es van controlar a OD 600 després de la inoculació inicial a la mateixa concentració. Com es mostra a la figura 2, no es van detectar diferències de creixement entre WT-pAL i WT-pAL-gp39, demostrant que l'expressió de SWU1gp39 no afecta el creixement de M. smegmatis en un medi 7H9 suplementat amb un 0, 05% Tween 80 i un 0, 2% glicerina. En presència d’Hyg, les cèl·lules WT-pAL van començar a créixer i van entrar en fase logarítmica de 3h de retard en comparació amb l’absència d’Hyg. En canvi, el WT-pAL-gp39 tractat amb Hyg era incapaç de créixer, encara que PALACE contenia un casset de resistència Hyg (Fig. 2A). Un defecte similar de creixement es va trobar quan es van cultivar WT-pAL i WT-pAL-gp39 en medi M9 suplementats amb glucosa com a única font de carboni, però la soca WT-pAL-gp39 pot créixer fins a la fase logarítmica després de 60 h (Fig. 2B). Per determinar si els gens homòlegs d'EagleEye i Serenity tenen una funció similar, els gens relacionats van ser sintetitzats per l'empresa comercial i expressats en M. smegmatis mitjançant la utilització del mateix plasmidi shuttle pALACE (anomenat WT-pAL-E i WT-pAL-S) ( Fig. 1E). Com era d'esperar, WT-pAL-E i WT-pAL-S també van mostrar algun defecte de creixement en presència de Hyg (Fig. 2C, D). Les taxes de creixement també es van provar quan WT-pAL i WT-pAL-gp39 van exposar-se a altres antibiòtics de les plaques. Com es mostra a la Fig. 2E, es va observar un defecte destacat en el creixement a l'exposició a isoniazida, eritromicina, norfloxacina i ampicilina. Tot i que M. smegmatis té una resistència intrínseca a l’amplicil·lina a causa de la seva estructura complexa de la paret cel·lular, la SWU1gp39 sobreexpressada pot potenciar la sensibilitat a l’antibiòtic.

Image

Les soques bacterianes de WT-pAL, WT-pAL-gp39 ( A ), WT-pAL-E ( C ) i WT-pAL-S ( D ) es van cultivar en medi M9 ( B ) o Middlebrook 7H9 suplementat amb un 0, 05% Tween 80, 0, 2% glicerina i 0, 25% acetamida, amb o sense higromicina (100 μg / ml). La OD 600 es va determinar a un interval de 3 h. ( E ) Les dilucions en sèrie de deu vegades de WT-pAL i WT-pAL-gp39 es van detectar a Middlebrook 7H10 que contenia isoniazida (4 μg / ml), eritromicina (16 μg / ml), norfloxacina (1 μg / ml) i ampicilina (100 μg) / ml). A continuació, el resultat es va registrar quan es va incubar a 37 ° C durant 3 dies. Les dades reportades representen el mitjà (n = 3) ± SD (desviació estàndard).

Imatge a mida completa

L’expressió de SWU1gp39 en M. smegmatis pot potenciar múltiples fàrmacs contra la tuberculosi

El WT-pAL-gp39 presenta un defecte de creixement en presència de múltiples antibiòtics, incloent isoniazida, eritromicina, norfloxacina i ampicilina. Per determinar si l'expressió de SWU1gp39 comprometrà la supervivència durant l'estrès antibiòtic letal, vam exposar les cèl·lules WT-pAL i WT-pAL-gp39 a diverses concentracions de diversos compostos antimicrobians (Fig. 3). Primer, es va analitzar l'efecte de la isoniazida, la supervivència de WT-pAL-gp39 va ser de 10 a 100 vegades més baixa que la de WT-pAL (Fig. 3A). Un fenomen similar es va observar quan es van tractar WT-pAL i WT-pAL-gp39 amb diverses concentracions d’eritromicina durant 24 hores i norfloxacina durant 4 hores (Fig. 3B, C). Aquestes dades indiquen que la proteïna SWU1gp39 contribueix a l’activitat letal de la isoniazida, l’eritromicina i la norfloxacina contra cèl·lules de tipus salvatge. Per entendre millor el paper de SWU1gp39 en els bacteris per una forta tensió, es van provar altres tres fluoroquinolones a WT-pAL i WT-pAL-gp39. Es van trobar taxes de supervivència diferencial quan es van tractar WT-pAL i WT-pAL-gp39 amb ciprofloxacina (Fig. 3D) i ofloxacina (Fig. 3E), però no es va trobar diferència quan es va tractar amb moxifloxacina (Fig. 3F). La kanamicina, un antibiòtic aminoglicòsid, mata bacteris dependents de ROS, però no es va trobar diferència quan es va tractar WT-pAL i WT-pAL-gp39 amb kanamicina. Per discriminar si SWU1gp39 afecta l'estrès de la paret cel·lular o de la membrana en les micobacteries, es va provar la vancomicina, un altre antibiòtic de síntesi de la paret cel·lular. La vancomicina s’uneix al terminal D-ala-D-ala de la cadena pentapeptídica de les molècules precursores del peptidoglicà a la part exterior de la membrana cel·lular, afectant així només la maquinària de síntesi de la paret cel·lular dels bacteris. Experiments de la corba de matar van revelar que WT-pAL-gp39 és més susceptible a la vancomicina que la WT-pAL, cosa que indica que SWU1gp39 afecta molt la integritat de la paret cel·lular.

Image

La soca control (WT-pAL, OD 600 = 1) i la soca recombinant (WT-pAL-gp39, OD 600 = 1) es van diluir en medi 7H9 i després es van tractar amb isoniazida durant 12 h ( A ), eritromicina durant 24 h ( B ), norfloxacina durant 4 h ( C ), ciprofloxacina durant 4 h ( D ), ofloxacina durant 4 h ( E ), moxifloxacina per 2 h ( F ), kanamicina durant 2 h ( G ), rifampicina durant 12 h ( H ) o vancomicina durant 10 h ( I ) com a concentracions indicades. Símbols: cercle buit, WT-pAL; quadrats buits, WT-pAL-gp39. Es van realitzar experiments tres vegades i es van obtenir resultats similars, les barres d’error indiquen desviació estàndard.

Imatge a mida completa

Per determinar la sensibilitat de WT-pAL-gp39, es van determinar MIC de WT-pAL i WT-pAL-gp39 en medi líquid 7H9 a 37 ° C mitjançant el mètode de dilució del caldo que conté 0, 25% d'acetamida. Els resultats van confirmar que WT-pAL-gp39 és sensible a isoniazida, norfloxacina, ciprofloxacina, ofloxacina, àcid nalidixic, eritromicina (Taula 1). Els MIC de WT-pAL-gp39 són entre 2 i 8 vegades inferiors al WT-pAL per a aquests antibiòtics (Taula 1). La sensibilitat del WT-pAL-gp39 a altres antibiòtics, inclosa la moxifloxacina, la kanamicina, la capreomicina, es va mantenir sense canvis.

Taula completa

L’expressió Gp39 condueix a una augmentada sensibilitat de M. smegmatis a diverses tensions ambientals

Els factors d’estrès ambientals són importants per al creixement del micobacteri, l’èxit de la M. tuberculosis a l’hoste requereix la manipulació de diverses tensions ambientals, com el pH baix, les tensions oxidatives. Per determinar si l’expressió gp39 també afecta la resposta bacteriana a les tensions ambientals habituals, es va comparar la resposta de la soca WT-pAL-gp39 i la soca del control del vector buit amb diverses tensions. La soca WT-pAL-gp39 va mostrar una supervivència reduïda després de l'exposició a 52 ° C durant 20 min (Fig. 4A) i un pH baix durant 6 h (Fig. 4B) en contrast amb el control del vector buit. Per determinar l'efecte del peròxid d'hidrogen sobre WT-pAL-gp39 i WT-pAL, es va utilitzar la difusió del disc (Fig. 4C). La soca WT-pAL-gp39 era més sensible a l'estrès redox mitjançant tractament amb peròxid d'hidrogen respecte al WT-pAL, ja que la zona d'inhibició era significativament més gran per a l'expressió SWU1gp39 en comparació amb el control vectorial (Fig. 4D). En conjunt, aquests resultats van mostrar que l'expressió SWU1gp39 va augmentar la sensibilitat de M. smegmatis a diverses tensions ambientals.

Image

( A ) Supervivència de WT-pAL i WT-pAL-gp39 després del tractament amb xocs de calor. ( B ) Supervivència de WT-pAL i WT-pAL-gp39 després del tractament amb pH baix. ( C ) Es va realitzar un assaig de difusió de discs utilitzant discos que contenien 1% de H 2 O 2 . ( D ) Es va mesurar la zona de diàmetre de la inhibició completa. Les dades reportades representen el mitjà (n = 3) ± SD.

Imatge a mida completa

L’expressió Gp39 regula la transcripció de múltiples gens de M. smegmatis

Per obtenir una visió detallada dels canvis reguladors de M. smegmatis expressats per SWU1 gp39, es va comparar l’alteració de la transcripció global de la soca recombinant (WT-pAL-gp39) i la tensió de control del vector buit (WT-pAL) durant la fase de registre mig. mitjançant la seqüenciació del transcriptoma RNA-Seq. Un total de 867 gens (els detalls figuren en els materials complementaris) mostren transcripció diferencial significativa en WT-pAL-gp39, incloent 511 gens regulats i 356 gens regulats. Basada en l’ontologia gènica i l’anàlisi de KEGG, la soca recombinant va mostrar una expressió diferencial d’una àmplia gamma de gens implicats en el procés metabòlic (Fig. 5). SWU1gp39 expressat en M. smegmatis va potenciar la letalitat de diversos medicaments contra la tuberculosi, però es va trobar que pocs gens estaven directament implicats en antibiòtics, excepte MSMEG_6440 ( Rv3854c , ethA), MSMEG_5312 , MSMEG_1420 i MSMEG_5102 (taula 2). ETH és un prodroc, activat per la monooxigenasa EthA que conté dinucleòtids de NADPH, específica del NADPH ( MSMEG_6440 o Rv3854c ). Vam trobar que WT-pAL-gp39 presentava algun defecte de creixement al medi sòlid que contenia la concentració indicada d’ETH (Fig. S1). Això pot ser degut a una expressió EthA regulada o a un ETH més activat. Segons el nostre coneixement, aquests gens no poden explicar per què WT-pAL-gp39 es va fer més sensible als múltiples antibiòtics. Curiosament, el WT-pAL-gp39 va descartar significativament els gens implicats en el metabolisme dels lípids, inclosos el fadD, acpM, kasA, kasB, accD6 (taula 2). Els àcids micòlics són àcids grassos importants i específics de cadena llarga essencials per a l’embolcall cel·lular de M. tuberculosis . La biosíntesi de precursors d’àcids micòlics requereix dos tipus de síntesi d’àcids grassos (FASs), l’enzim multifuncional FAS I en forma d’eucariota i el sistema FAS II que depèn de la proteïna portadora d’acils (ACP) (Fig. 5D). Els gens que codifiquen els enzims FAS II es distribueixen en tres unitats de transcripció 25 independents. El primer està format per fabD-acpM-kasA-kasB-accD6 (Fig. 5D), i tots estan regulats en WT-pAL-gp39. MabR (regulador de biosíntesi d’àcid micòlic) es va identificar originalment com un regulador transcripcional putatiu codificat per MSMEG_4324 ( Rv2242 ) i situat immediatament aigües amunt del principal oper Fas II. La sobreexpressió de MabR en M. smegmatis reprimeix la transcripció de F D, acp M, kas A, kas B i va anar acompanyada de nivells reduïts d’àcids micòlics 26 . Diversos gens implicats en la degradació de lípids també es van regular en WT-pAL-gp39 (taula 2). Aquests resultats suggereixen que SWU1gp39 podria afectar la biosíntesi de components d’àcids micòlics de la paret cel·lular.

Image

( A ) Anàlisi de classificació KEGG de dades transcripcionals de WT-pAL i WT-pAL-gp39. ( B ) ROS determinat en WT-pAL i WT-pAL-gp39. Les dades reportades representen el mitjà (n = 3) ± SD. ( C ) Comparació dels nivells NAD + i NADH en WT-pAL i WT-pAL- g39 . Les dades reportades representen el mitjà (n = 3) ± SD. ( D ) Les vies FAS I i FAS II en micobacteris.

Imatge a mida completa

Taula completa

L’expressió Gp39 indueix alteracions fisiològiques relacionades amb redox

El nostre anterior transcriptoma de soca recombinant SWU1gp39 es va associar amb un metabolisme global alterat. Es va informar que la letalitat dels antibiòtics estava relacionada amb alteracions fisiològiques relacionades amb el redox 27 . Per tal de caracteritzar el potencial redox de la soca i vector recombinant SWU1gp39, es va utilitzar DCFH-DA per controlar el nivell de ROS. El DCFH-DA penetra fàcilment a les cèl·lules bacterianes 28, 29 ; un cop entrats a les cèl·lules, el DCFH-DA es converteix per esterases cel·lulars en un compost que no penetra en les membranes que pot oxidar-se a una forma fluorescent mitjançant ROS 28 . Les cèl·lules bacterianes es van tractar amb 10 μM DCFH-DA i després es va detectar la intensitat de fluorescència amb excitació a 488 nm i emissió a 515 nm. Tal com es mostra a la figura 5B, la soca recombinant presentava un etiquetatge de fluorescència més elevat que la soca control vectorial. Els nivells de ROS entre WT-pAL-gp39 i WT-pAL també es van confirmar mitjançant el segon mètode descrit a continuació.

Com que FAS II utilitza NADH com a cofactors i múltiples gens relacionats amb el metabolisme de NAD + es van descartar en una soca recombinant basada en dades transcriptòmiques (vegeu la TAULA S1 del material suplementari), l’expressió de SWU1gp39 en M. smegmatis podria canviar el nivell de NAD + / NADH cel·lular. Per tant, es van mesurar els nivells de NAD + i NADH cel·lulars. Els resultats van mostrar que l'expressió SWU1gp39 va disminuir el nivell de NAD + cel·lular a les cèl·lules WT-pAL-gp39 en comparació amb WT-pAL (Fig. 5C). Mentrestant, el nivell de NADH a les cèl·lules WT-pAL-gp39 va ser lleugerament superior al de WT-pAL. La relació de NAD + / NADH va ser un 20% més baixa en WT-pAL-gp39 que la de WT-pAL (Fig. 5C).

L’expressió Gp39 afecta la motilitat superficial i la formació de biofilmes

Com que l'expressió SWU1gp39 mostrava susceptibilitat a múltiples antibiòtics dirigits a la paret cel·lular, vam determinar si gp39 pot afectar la motilitat de lliscament i la formació de biofilm. Sorprenentment, el WT-pAL-gp39 presenta un lliscament millorat a la superfície de plaques d'agar mitjà mínimes en comparació amb WT-pAL (Fig. 6A, B). En alguns bacteris patògens, com Vibrio cholerae , Pseudomonas aeruginosa , Haemophilus influenza , Streptococcus sp., Escherichia coli i M. tuberculosis , la persistència de l’hoste i la tolerància als antibiòtics estan estretament correlacionades amb la capacitat de formar biofilms 30 . Al dia 3 després de la inoculació, el cultiu de la soca control ja ha colonitzat tota la superfície del medi líquid, mentre que la soca recombinant només formava escletxes esporàdiques en fase líquida i algunes illes de creixement a la superfície (Fig. 6C). Aquests resultats recorden un efecte de SWU1gp39 a la paret cel·lular del micobacteri. La microscòpia electrònica d'exploració no va mostrar una diferència sorprenent entre WT-pAL-gp39 i WT-pAL, però va mostrar més fosses a la superfície de WT-pAL-gp39 (Fig. 7A-D i Fig. S2). Consistent amb una paret cel·lular defectuosa, WT-pAL-gp39 es va fer més sensible al detergent sulfat de dodecil sòdic (SDS) després del tractament amb temps i concentració diferents (Fig. 7E, F). El WT-pAL-gp39 era almenys 10-100 vegades més susceptible a SDS que WT-pAL.

Image

( A ) La motilitat lliscant de M. smegmatis sobre un medi M63. ( B ) El zoma de diàmetre de la colònia de motilitat. Les dades reportades representen el mitjà (n = 3) ± SD. ( C ) Creixement superficial de biofilm de la soca de M. smegmatis .

Imatge a mida completa

Image

Micrografies electròniques d’escaneig de WT-pAL ( A, B ) i WT-pAL-gp39 ( C, D ). Els efectes de SWU1gp39 sobre la supervivència bacteriana després del tractament amb SDS com concentració indicada ( E ) i temps ( F ). Símbols: cercle buit, WT-pAL; quadrats buits, WT-pAL-gp39. Es van realitzar experiments tres vegades i es van obtenir resultats similars, les barres d’error indiquen desviació estàndard.

Imatge a mida completa

La permeabilitat de la paret cel·lular de M. smegmatis recombinant Gp39 està alterada

M. smegmatis amb expressió SWU1gp39 va ser més sensible a diversos antibiòtics hidrofòbics, incloent-hi eritromicina, norfloxacina, ciprofloxacina, ofloxacina i rifampicina, així com a isoniazida i vancomicina hidrofílica (Fig. 3). Tot i això, la sensibilitat a altres antibiòtics hidrofòbics o hidròfils, moxifloxacina, kanamicina, estreptomicina, capreomicina i cloramfenicol no es va mantenir (Taula 1).

Per examinar si l’augment de la sensibilitat al medicament dels bacteris recombinants esmentats es produeix per un augment general de la permeabilitat cel·lular, hem utilitzat espectroscòpia de fluorescència per mesurar les acumulacions de bromur d’etid i Nile Red, representants dels compostos hidrofílics i hidrofòbics, respectivament 31. . Els resultats van mostrar que tots dos compostos es van acumular més ràpidament i a nivells més alts en la soca recombinant que la soca de control del vector buit, cosa que indica un augment de la permeabilitat de la paret cel·lular (Fig. 8A, B).

Image

( A ) Els cultius de fase mitja log del control WT-pAL (OD 600 = 0, 5) i les soques WT-pAL-gp39 (OD 600 = 0, 5) es van incubar en PBS amb 25 mM de glucosa i 2μg / ml bromur d’etidi. Les dades reportades representen el mitjà (n = 3) ± SD. ( B ) Els cultius de fase mitja log del control WT-pAL i les soques WT-pAL-gp39 van ser incubats en PBS que contenien glucosa de 25 mM i una taca vermella del Nil de 2 μM. Les dades reportades representen el mitjà (n = 3) ± SD. ( C ) Àcid gras extret de WT-pAL i WT-pAL-gp39 analitzat per espectrometria de masses per cromatografia de gas (GC-MS). Símbols: cercle buit, WT-pAL; places plenes, WT-pAL-gp39.

Imatge a mida completa

Els àcids micòlics són àcids grassos importants i específics de cadena llarga essencials per al micobacterium dell envelop. Els micobacteris tenen dos sistemes de sintasa d’àcids grassos, el tipus sintasi de l’àcid gras tipus eucariota (FAS I) i el FAS II procariota. El FAS I micobacterià sintetitza els àcids grassos en un patró bododal, que són allargats pel sistema FAS II per produir àcids micòlics, àcids grassos de cadena llarga, que són els principals components de la paret cel·lular micobacteriana. FAS I i FAS II utilitzen NADPH i NADH com a cofactors. Les nostres dades van demostrar que diversos gens que codificaven els enzims FAS II estaven regulats i es va acumular el cofactor NADH, cosa que suggereix que el FAS II podria afectar-se per SWU1gp39. Per explorar si l’expressió de SWU1gp39 en M. smegmatis pot canviar la composició d’àcids grassos, es va utilitzar l’espectrometria de masses de cromatografia de gas (GC-MS) per detectar els àcids grassos de WT-pAL-gp39 i WT-pAL. Hi ha 14 compostos principals identificats a WT-pAL-gp39 i WT-pAL, de C7 a C24 (Fig. 8C). Es van trobar diversos compostos acumulats a WT-pAL-gp39, especialment C7: 0, C8: 0, C11: 0, C14: 0, MeC15: 0, C18: 1ω5 (c), C24: 0 (Fig. 8C). Les dades indiquen que SWU1gp39 pot alterar l’abundància relativa d’àcids grassos en M. smegmatis .

Discussió

La M. tuberculosi multirresistent (MDR-MTB) i la M. tuberculosi (XDR-MTB) resistents als fàrmacs representen un repte formidable per a la salut pública mundial. Cal urgentment nous medicaments efectius o potenciadors de petites molècules d'antibiòtics bacteriocides 32 . Les proteïnes de reconeixement de peptidoglicans (PGRPs) són una família de proteïnes immunes innates antibacterianes conservades en evolució 33 . Els PGRPs maten bacteris resistents als antibiòtics, l’orientació sinèrgica d’estrès oxidatiu, tiol i metalls es pot utilitzar per al desenvolupament de nous enfocaments per matar bacteris resistents als antibiòtics 34 . La vitamina C (VC) és un nutrient essencial per a alguns mamífers i un potent antioxidant. L’activitat de la VC contra la tuberculosi M. sensible a les drogues, MDR i molt resistent als medicaments (XDR) M. es va associar amb la presència d’alta concentració de ferro, producció d’espècies reactives d’oxigen (ROS) i danys en l’ADN. El phage, com a némesi del bacteri, és una eina útil per a la investigació científica. S’esperava molt les fases per al tractament de bacteris resistents als fàrmacs.

En aquest estudi, vam demostrar que SWU1gp39 va expressar M. smegmatis va mostrar un canvi de sensibilitat a múltiples antibiòtics, incloent isoniazid (INH), eritromicina (ERY), fluoroquinolones, rifampicina (RIF), vancomicina (VAN), ampicilina (AMP) quan. La isoniazida és un pro-fàrmac, dirigit a l’enoyl ACP reductasa InhA després d’haver estat activat per la catalasa peroxidasa KatG 10 . L’eritromicina és un antibiòtic macròlid dirigit al ribosoma 50S i que inhibeix la síntesi de proteïnes bacterianes 35 . Les fluoroquinolones són una classe de fàrmacs sintètics, que tenen com a objectiu la gira (gyrA o gyrB) i també funcionen mitjançant l'efecte secundari de les dosis letals de radicals hidroxils produïts 36 . La rifampicina és un medicament anti-tuberculosi de primera línia, que inhibeix la transcripció de M. tuberculosis en unir-se a la subunitat beta de l’ARN polimerasa (RpoB) codificada pel gen rpoB 37, 38 . La rifampicina també va induir la formació de radicals hidroxil 39 . La vancomicina i l’ampicil·lina inhibeixen el creixement dels bacteris orientant-se a la paret cel·lular dels bacteris i també condueixen a la producció de radical hidroxil 40 . Les nostres dades del transcriptoma van demostrar que la transcripció de la majoria dels gens associats a l’acció dels antibiòtics no va canviar per gp39 (taula 2), cosa que suggereix un paper poc menyspreable del WT-pAL-gp39 en la regulació de la transcripció de gens coneguts per estar relacionats amb l’acció dels antibiòtics. El WT-pAL-gp39 presentava un defecte de creixement en presència d’higromicina en comparació amb WT-pAL tot i que pALACE conté un casset de resistència a la higromicina. Es va especular que el WT-pAL-gp39 té una permeabilitat a la paret cel·lular més gran en comparació amb el WT-pAL.

La supervivència intracel·lular de la M. tuberculosis comporta una capacitat extraordinària per afrontar diversos esforços. Les nostres dades van demostrar que WT-pAL-gp39 pot debilitar la capacitat de Mycobacteria de manejar múltiples tensions ambientals incloent-hi un baix pH, xocs de calor i peròxid d’hidrogen, rellevants per a l’eficàcia dels antibiòtics 41, 42 . El defecte de la paret cel·lular es pot trobar en alguns mutants, com ara mutants sensibles a l’àcid 43, exopolifosfatasa Rv1026 / PPX2 44 i mutació lipoproteïna 45 . La capacitat de supervivència de WT-pAL-gp39 es va reduir de 10 a 100 vegades en comparació a la de les cèl·lules WT-pAL quan van ser exposades a SDS durant diversos moments o diverses concentracions, cosa que suggereix un defecte de la paret cel·lular en WT-pAL-gp39. Es van descobrir múltiples antibiòtics orientats a la paret cel·lular, i és temptador explorar si aquests antibiòtics orientats a la paret cel·lular tenen efectes sensibilitzants similars. El vermell de Congo, un colorant que s'uneix a les lipoproteïnes presents a la superfície micobacteriana 46, es va utilitzar per caracteritzar modificacions que afecten la paret cel·lular 45 . Després de 4 dies de creixement en un medi sòlid que contenia Congo Red a 37 ° C (sense Tween80), no es va observar cap diferència entre les dues soques de M. smegmatis (Fig. S3). El biofilm juga un paper crucial en la tolerància i la persistència als antibiòtics en la M. tuberculosis 47 . En aquest estudi, vam trobar que l'expressió SWU1gp39 estava associada a una formació reduïda de biofilm, però que va augmentar la motilitat superficial. Això és coherent amb els resultats anteriors que la susceptibilitat als antibiòtics de WT-pAL-gp39 està associada a l'estressor i biofilm del medi ambient, però no a la captació del Congo Red.

Aquest treball va demostrar per primera vegada que la proteïna micobacteriòfag SWU1gp39 va alterar la permeabilitat de la paret cel·lular, que es va manifestar per la captació del compost polar EtBr i el colorant lipofílic vermell del Nil. La resistència intrínseca dels micobacteris a la majoria d’agents antimicrobianos s’atribueix generalment a una paret cel·lular inusual dominada per lípids i carbohidrats, que proporciona una barrera a compostos nocius i limita l’absorció de medicaments 48, 49 . Estudis anteriors han demostrat que l'absorció micobacteriana del vermell del Nil està directament relacionada amb els components dels lípids de la paret cel·lular i la susceptibilitat als fàrmacs lipòfils 50, 51 . La permeabilitat a la paret cel·lular del micobacteri per EtBr també està estretament relacionada amb la resistència als antibiòtics 52 . Arribem a la conclusió que WT-pAL-gp39 pot sensibilitzar el recombinant a múltiples tensions mitjançant l’augment de la permeabilitat de la paret cel·lular. Més acumulació d’àcids grassos de cadena curta en WT-pAL-gp39 que en el WT-pAL va suggerir que SWU1gp39 va interrompre la síntesi normal d’àcids grassos de cadena llarga, els components principals de la paret cel·lular dels micobacteris.

La teràpia amb fagos es va renovar com a alternativa prometedora als antibiòtics per combatre patògens resistents 53 . El bacteriòfag enginyós amb xarxes gèniques orientades a proteïnes sobreexpressades pot augmentar l'efecte bactericida dels antibiòtics 54 . Per a aplicacions terapèutiques del fag, es pot utilitzar SWU1gp39 com a adjuvant o potentitzador d’antibiòtics d’ampli espectre, a més d’incloure’s al bacteriòfag dissenyat per millorar la matança bacteriana per antibiòtics, especialment medicaments anti-tuberculosi de primera línia com la isonia i la rifampicina.

Mètodes

Condicions de soca, plasmidi i creixement dels bacteris

M. smegmatis mc 2 155 i bacteris recombinants cultivats en medi Middlebrook 7H9 complementats amb plaques de 0, 05% Tween80 i 0, 2% glicerí o plaques Middlebrook 7H10 complementades amb 0, 5% glicerina. El mitjà Luria-Bertani s'utilitzava per a cultivar soques E. coli . Es van afegir antibiòtics a les següents concentracions: ampicil·lina, 100 μg / ml; kanamicina, 50 μg / ml per E. coli i 20 μg / ml per M. smegmatis ; higromicina, 75 μg / ml per E. coli o 50 μg / ml per M. smegmatis . Totes les cultures es van incubar a 37 ° C.

Expressió de la proteïna SWU1gp39 marcada amb His

El marc de lectura obert que codifica el gen SWU1 gp39 es va amplificar per PCR a partir de l’ADN genòmic SWU1 utilitzant l’imprimació avançada 5 ′ ATGGATCCATGTTCGAACTG3 ′ que conté un lloc Bam HI (subratllat) i el revers 5 ′ AATCGATTCACAGGGGCACCGCTT3 que conté un lloc Cla I (subratllat). El producte PCR d’aproximadament 250 pb es va clonar en el plasmidi llançadora Mycobacteria - Escherichia coli shuttle. La veritat de la seqüència es va confirmar mitjançant la seqüenciació d'ADN.

Corbes de creixement bacterià

Les soques recombinants WT-pAL i WT-pAL-gp39 es van cultivar en un medi 7H9 que contenia 0, 5% glicerol, 0, 05% Tween 80 i 0, 25% acetamida fins que OD 600 va arribar a 0, 8-1, 0. A continuació, els cultius es van restablir en un medi fresc de 7H9 amb la proporció de dilució 1: 1000. Es van incubar els cultius a 37 ° C i van agitar durant tota la fase de creixement. Les mostres es van recollir a la mateixa etapa de creixement i es van mesurar els valors de 600 OD cada 3 h després de l'inici del creixement. Els experiments es van realitzar per triplicats i es van utilitzar els valors mitjans per generar corbes de creixement.

Corbes de supervivència

Els cultius de fase mitja exponencial de WT-pAL i WT-pAL-gP39 es van diluir en medi 7H9 i es van cultivar a 37 ° C, tractats per a diverses concentracions, tal com s’indica amb antibiòtics. Després del temps indicat, es va estimar que les cèl·lules supervivents es van formar mitjançant colar amb agar lliure de medicaments. El percentatge de cfu recuperat es va determinar en relació amb un control no tractat mostrejat en el moment en què s’hi van afegir antibiòtics. Tot l’experiment es va repetir almenys tres vegades.

Mètode de difusió del disc

El mètode de difusió del disc es va utilitzar per mesurar qualitativament les diferències en les sensibilitats H 2 O 2 o SDS entre el micobacteri WT-pAL i WT-pAL-gp39. Es van utilitzar cultius de fase mig-exponencials per preparar la gespa de cèl·lules tal com s’ha descrit anteriorment 55 . Es va detectar una concentració indicada de H 2 O 2 o SDS en discos de filtre de Whatman de 5, 5 mm de diàmetre col·locats a la gespa bacteriana. Després de la incubació durant la nit a 37 ° C, es va mesurar el diàmetre de la zona d’inhibició completa. Tot l’experiment es va repetir almenys tres vegades.

Proves puntuals

El WT-pAL i el WT-pAL-gp39 es van cultivar fins a un OD 600 de 0, 8–1, 0 provat per la seva susceptibilitat als antibiòtics detectant una dilució en sèrie 10 vegades inicialment a Middlebrook 7H10 que contenia 0, 25% d’acetamida i una gamma de fàrmacs. La concentració d'antibiòtics per a proves puntuals, tal com es descriu a continuació: isoniazid (4 μg / ml), eritromicina (16 μg / ml), norfloxacina (1 μg / ml), ampicilina (100 μg / ml).

Determinació del MIC

Els MIC de medicaments contra la tuberculosi es van determinar com es va descriure anteriorment 2 . Breument, cal diluir el caldo amb inspecció visual d’una sèrie de tubs que contenen cadascun d’uns 10 5 bacteris en 1 ml de medi 7H9 complementat amb concentracions de fàrmac augmentant en dos cops i 0, 25% d’acetamida. Després de 3 dies d’incubació a 37 ° C, la concentració més baixa que impedia un creixement visible es va definir com a MIC.

Xoc de calor i repte àcid

Cultius de fase mig exponencials de WT-pAL i WT-pAL-gp39 es van rentar amb tampó fosfat (pH 7, 0), i després es van diluir OD 600 = 0, 5. Per xoc de calor, els bacteris es van incubar a 52 ° C durant 20 min, després es van diluir en sèrie en tampó fosfat i es van localitzar en plaques de 7H9. Per a estudis de desafiament d'àcids, els bacteris es van incubar en un medi de pH baix durant 6 h, després es van diluir en sèrie en tampó fosfat i es van localitzar en plaques de 7H9.

ARN-seq

Després de l'exposició de cultius logarítmicament en cultiu (WT-pAL i WT-pAL-gp39, OD 600 = 0, 8) a l'acetamida inductora durant almenys 4 h, es va collir ARN mitjançant mètodes basats en Trizol. Les mostres d’ARN es van tractar amb DNasa i es va obtenir l’ARN purificat mitjançant l’ús del kit net (RIANGEN). Les mostres van ser enviades a Shanghai Biotechnology Corporation per a la construcció i seqüenciació de biblioteques mitjançant Illumina Hi seq 2500 (Illumina). La qualitat de la seqüència dels conjunts de dades va ser comprovada per Aganalent Bioanalyzer 2100. Les dades de seqüenciació del transcriptoma (RNA-seq) es van alinear amb el genoma de M. smegmatis mc 2 155 obtingut a partir de NCBI (//www.ncbi.nlm.nih.gov/genome/?term = MC2_155). El nombre de lectures es calculava el nivell d'expressió gènica. Per fer-la comparable entre diferents gens o mostres, el nombre de lectures es va convertir en FPKM (fragments per quilobase del model exó per milió de lectures mapades) per a la normalització de l'expressió gènica 56 . Cada número de fragments de gen es va calcular després de l'alineació de TopHat per HTseq 57, després es va dur a terme la normalització mitjançant TMM (mitjana retallada dels valors M) 58 i es va calcular la FPKM mitjançant un guió Perl.

Anàlisi de la ontologia gènica i classificació KEGG

El transcriptoma d’anotació de genes Ontologia (GO) es va realitzar mitjançant la base de dades UniProt-GOA (//www.ebi.ac.uk/GOA/). Les proteïnes es van classificar en procés biològic, compartiment cel·lular i funció molecular segons la anotació de Ontologia gènica. L’enciclopèdia de genes i genomes (KEGG) de Kyoto es va utilitzar per anotar les rutes: en primer lloc, mitjançant les eines de servei en línia de KEGG KAAS per anotar proteïnes, en segon lloc, mitjançant les eines de servei en línia KEGG mapper KEGG per associar la base de dades de ruta de ruta KEGG, finalment, mitjançant la base de dades InterPro i InterProScan per anotar dominis de proteïnes i aplicar la base de dades CORUM per anotar el complex proteic.

Estudi de microscòpia electrònica d’escaneig

Les cèl·lules WT-pAL i WT-pAL-gp39 es van cultivar durant aproximadament 24 hores fins que el OD 600 arriba a 1, 0 en 7H9. Els cultius es van recol·lectar per centrifugació i es van tornar a suspendre els pellets en solució de glutaraldehid al 2, 5%. Les mostres es van deshidratar en una sèrie ascendent d’etanol. Després de l'assecat en punt crític, les mostres van ser pulverizades amb platí i observades mitjançant una microscòpia electrònica d'escaneig (SEM; FEI Quanta 200).

Prova d’acumulació de bromur d’etidium / assaig d’eflux i assajos de captació vermella del Nil

Les soques de micobacteri es van cultivar en 7H9 fins a un OD 600 = 1, 0, rentades dues vegades amb solució salina tamponada amb fosfat (PBS, 137 mM NaCl, 4, 3 mM Na 2 HPO 4, 1, 4 mM KH 2 PO 4, pH 7, 0) i es van tornar a suspendre. Les cèl·lules resuspendents es van determinar i ajustar a 0, 4 i contenir glucosa 25 mM. Després de reposar 5 minuts, es van afegir per duplicat 200 µl de les cèl·lules de suspensió a un fluoroplate negre de 96 pous i es van afegir Nile Red i EtBr a les concentracions finals. L’acumulació d’aquests colorants es va mesurar amb una excitació de 540 nm i una emissió de 630 nm per Nile Red i una excitació de 545 nm i una emissió de 600 nm per EtBr.

Determinació del ROS en cèl·lules planctòniques

La producció intracel·lular de ROS es va detectar mitjançant la reducció de nitro blau tetrazoli (NBT) (nitram blau diformazan). Les suspensions bacterianes (500 µl de fase estacionària) es van inocular amb 500 µl de NBT (1mg / ml) a 37 ° C durant 30 min. Les cèl·lules bacterianes es van separar del sobrenedant per centrifugació a 1500 g durant 10 min, i després es van tractar amb 600 µl DMSO i 800 µl de PBS, pH 7, 0. La reducció de la NBT es va mesurar com a blau de formazà a 575 nm.

El segon mètode que vam utilitzar per a la determinació del ROS va ser el kit d’assaig d’espècies d’oxigen reactiu (Institut Beyotime de Biotecnologia, Xina) basat en el deacetat de 2 ′, 7’-diclorodihidrofluoresceïna (DCFH-DA) per determinar la generació de ROS. Hem obtingut mostres de cèl·lules en fase logarítmica i les hem tenyit amb 10 μM DCFH-DA. Es va estimar la intensitat de fluorescència amb excitació a 488 nm i emissió a 515 nm.

Anàlisi de concentració NAD + i NADH

Les concentracions de NAD + i NADH es van mesurar mitjançant un kit d'assaig NAD + / NADH (BioAssay Systems). El cultiu de M. smegmatis es va diluir a OD 600 de 0, 5 i després es va rentar dues vegades amb una solució salina tampó de fosfat fred (PBS). Es van suspendre els pellets cel·lulars amb 100 μl de tampó d’extracció NAD + per a la mesura NAD + i 100 µl de tampó d’extracció NADH per a la mesura NADH. A continuació, els extractes es van escalfar a 60 ° C durant 5 min. Es va recollir el sobrenedant per al kit d’Assaig EnzyChrom NAD + / NADH.

Anàlisi d’àcids grassos

Els cultius de fase mig-exponencials es van extreure àcid gras M. smegmatis tal com es va descriure anteriorment 59 . La concentració d’àcids grassos es va determinar mitjançant un cromatògraf de gas Agilent 7890A amb un detector selectiu de massa 5975C (GC-MSD) equipat amb un mostreig automàtic Agilent 7693A i una columna capilar DB-5MS. El procediment d’anàlisi detallat es va descriure prèviament a 60 .

Anàlisi estadística

Les dades d'almenys tres rèpliques biològiques es van utilitzar per calcular els mitjans i la desviació estàndard (SD) amb finalitats gràfiques. L’anàlisi estadística utilitzada per la prova t de l’alumne no comparada, els asteriscs indiquen una diferència significativa estadísticament (* P <0.05; ** P <0.01; *** P <0.001).

Informació adicional

Com citar aquest article : Li, Q. et al . Mycobacteriophage SWU1 gp39 pot potenciar múltiples antibiòtics contra Mycobacterium alterant la permeabilitat de la paret cel·lular. Cci. Rep. 6, 28701; doi: 10.1038 / srep28701 (2016).

Informació complementària

Fitxers PDF

  1. 1.

    Informació complementària

Fitxers Excel

  1. 1.

    Informació complementària

Comentaris

En enviar un comentari, accepteu complir els nostres Termes i Directrius de la Comunitat. Si trobeu alguna cosa abusiva o que no compleix els nostres termes o directrius, marqueu-la com a inadequada.