Tmprss2: fusió de gen erg associada amb un càncer letal de pròstata en una cohort en espera | oncogen

Tmprss2: fusió de gen erg associada amb un càncer letal de pròstata en una cohort en espera | oncogen

Anonim
  • El 16 d’agost de 2007 es va publicar un Erratum a aquest article

Resum

La identificació de la TMPRSS2: fusió ERG en càncer de pròstata suggereix que diferents subtipus moleculars poden definir el risc de progressió de la malaltia. En sèries quirúrgiques, es va identificar la fusió TMPRSS2: ERG en el 50% dels tumors. Aquí, informem sobre una cohort basada en la població d’homes amb càncer de pròstata localitzat seguida d’una teràpia expectant (atenta) amb un 15% (17/111) TMPRSS2: fusió ERG . Es va identificar una associació estadísticament significativa entre TMPRSS2: fusió ERG i mort específica del càncer de pròstata (proporció d’incidència acumulada = 2, 7, P <0, 01, interval de confiança del 95% = 1, 3–5, 8). La reacció en cadena quantitativa de reversió-transcripció-polimerasa va demostrar l'expressió del gen regulat en estrògens (ERG) per associar-se a TMPRSS2: fusió ERG ( P <0.005). Aquestes dades suggereixen que els càncers de pròstata TMPRSS2: fusió ERG poden tenir un fenotip més agressiu, possiblement mediat a través d’una expressió ERG més gran.

Principal

Al diagnòstic inicial, el 91% dels 234 460 homes amb càncer de pròstata identificats als Estats Units el 2006 tindran una malaltia localitzada clínicament amb una taxa de supervivència 100% a 5 anys (Jemal et al., 2006). Les opcions de tractament actuals per al càncer de pròstata localitzat inclouen: prostatectomia radical, radioteràpia o teràpia expectant (atenta). A causa del resultat excel·lent a curt termini, independentment del tractament, cal equilibrar els riscos de la teràpia amb el risc de progressió de la malaltia. Un assaig aleatori va avaluar el benefici de la prostatectomia radical respecte a la teràpia expectant. L’estudi del grup escandinau de càncer de pròstata n º 4 va demostrar que la cirurgia va disminuir significativament el risc de mort per càncer de pròstata (Holmberg et al., 2002; Bill-Axelson et al., 2005). No obstant això, per evitar una mort específica del càncer de pròstata, 19 homes són sotmesos a tractament i alguns homes van morir malgrat la cirurgia radical. Warlick et al. (2006) van informar que després de definir un grup de risc mínim mitjançant paràmetres patològics i clínics, la teràpia expectant no es va associar amb un augment de la progressió de la malaltia quan es va administrar el tractament definitiu. Per tant, l’acceptació de la teràpia expectant depèn de l’avaluació precisa del risc per a la progressió de la malaltia del càncer de pròstata. La identificació de la fusió TMPRSS2: ETS en càncer de pròstata suggereix que diferents subtipus moleculars poden definir encara més el risc per a la progressió de la malaltia (Tomlins et al., 2005; Soller et al., 2006). La fusió gènica més comuna és TMPRSS2: ERG que es troba aproximadament al 50% de les cohorts basades en cirurgia estudiades fins a la data.

En primers estudis, les fusions gèniques de la regió 5 'no traduïda de TMPRSS2 (21q22.3) amb els membres de la família del factor de transcripció ETS , gen regulat per estrògens ( ERG ) (21q22.2), ETV1 ( 7p21.2 ) (Tomlins et al., 2005), o ETV4 (Tomlins et al., 2006) proporcionen un mecanisme per a la sobreexpressió dels gens ETS en càncers de pròstata. A més, la fusió d’un gen regulat per andrògens, TMPRSS2 i un oncogeni suggereix que la progressió de la malaltia pot variar en funció d’aquests subtipus moleculars. Un mecanisme comú per a la fusió gènica és la pèrdua de 2, 8 Mb d’ADN genòmic entre TMPRSS2 i ERG (Perner et al., 2006) (Figura 1a i b). En l'estudi actual, es caracteritza una cohort basada en la població respecte a la TMPRSS2: fusió ERG i explorarem el risc de metàstasi o mort específica del càncer de pròstata a partir de la presència de la fusió comuna TMPRSS2: ERG .

Image

( a - c ). El test FISH detecta el patró d’hibridació característic associat a TMPRSS2: fusió del gen ERG , que s’associa a la progressió de la malaltia. ( a i b ) Amb aquest sistema de sondes FISH multicolor, un nucli sense reordenació ERG demostra dos parells de senyals vermells i verds juxtaposats. Els senyals juxtaposats de vermell i verd a vegades formen un senyal de fusió groc ( b, fletxa). Un nucli amb reordenació ERG mostra la substitució d’un parell de senyals vermell-verd juxtaposat per un únic senyal vermell per l’al·lel traduït ( b ). Aquest patró d’hibridació és consistent amb una supressió de ∼ 2, 8 Mb d’ADN genòmic que abasta la porció telomèrica de la sonda ERG . ( c ) En un model de regressió d’incidència acumulada, es va valorar TMPRSS2: ERG com a determinant per a la incidència acumulada o metàstasis o mort específica del càncer de pròstata. Es va observar una diferència significativa en la supervivència a favor de TMPRSS2: casos negatius de fusió gènica ERG . CIR (CIR = 2, 7, P <0, 01, 95% CI = 1, 3–5, 8) es va realitzar mitjançant l’equació d’estimació ponderada tal com es va implementar a la biblioteca de cmprsk R (R Development Core Team, 2006). Es va realitzar una altra anàlisi estadística mitjançant SPSS 13.0 per a Windows (SPSS Inc., Chicago, IL, EUA).

Imatge a mida completa

S'ha descrit anteriorment la cohort de Watchful Waiting i es poden trobar detalls al material complementari (Johansson et al., 1989, 1992, 1997, 2004; Andren et al., 2006). En breu, la cohort comprèn 252 homes amb càncer de pròstata precoç (T1a-b, Nx, M0) diagnosticats per resecció transuretral de la pròstata o enenergia transgenical d’adenoma per a una hiperplàsia prostàtica benigna simptomàtica a l’Hospital Universitari Örebro, Suècia entre 1977 i 1991. Baseline L'avaluació al diagnòstic va incloure exploració física, radiografia de tòrax, exploració òssia i radiografia esquelètica (si cal). Els pacients van ser seguits de forma expectativa (sense tractament curatiu) i van rebre exàmens clínics, proves de laboratori i exploracions òssies cada 6 mesos durant els primers dos anys després del diagnòstic i, posteriorment, a intervals de 12 mesos. La progressió simptomàtica de la malaltia es va tractar amb teràpia privativa d’andrògens o radioteràpia pal·liativa.

Els pacients foren seguits fins a la mort per càncer de pròstata o censurats en un altre moment o fins al final del període d’observació a l’octubre del 2005. No es va perdre cap pacient per fer el seguiment. El punt final del present estudi va ser el càncer letal de pròstata, definit com a desenvolupament de metàstasis llunyanes o càncer de pròstata com a causa subjacent de la mort (temps de seguiment mitjà de 9, 1 anys, màxim 28 anys).

Un patòleg va revisar tota la resecció transuretral de les mostres de pròstata (TURP) per confirmar un diagnòstic de càncer de pròstata, determinar la puntuació de Gleason i el grau nuclear i estimar la càrrega del tumor tal com es va descriure anteriorment (Andren i altres, 2006). Aquest treball es va realitzar abans de l’avaluació de les dades moleculars. Es va muntar un microarray de teixit mitjançant un array manual (Rubin et al., 2005). La freqüència del TMPRSS2: reordenació ERG en càncer de pròstata es va avaluar mitjançant un assaig d’hibridació fluorescent in situ (FISH) (Perner et al., 2006). Aquest assaig FISH és una prova indirecta i, per tant, no pot confirmar directament la fusió de TMPRSS2: ERG (vegeu els materials addicionals per a més detalls). No obstant això, com ja vam informar anteriorment (Tomlins et al., 2005), l'anàlisi de l'amplificació ràpida de la finalitat de l'ARND (RLM-RACE) mediada per RNA-ligasa i seqüenciació del producte de la reacció en cadena de la transcripció inversa-polimerasa (RT-PCR) Els casos de càncer de pròstata amb ERG sobre expressió van revelar la fusió de TMPRSS2 amb ERG mitjançant PCR quantitativa (QPCR) i / o RACE. Això demostra que gairebé totes les mostres de càncer de pròstata amb sobreexpressió d'ERG tenen una reordenació i la sobreexpressió es produeix en el mateix nombre de casos que la reordenació.

Es van caracteritzar 111 casos per TMPRSS2: fusió ERG . Nouze-dos dels casos es van caracteritzar per FISH (Figura 1a i b), on 19, per als quals va fallar FISH, es van caracteritzar per QPCR. Les dificultats tècniques amb l’assaig FISH van incloure l’absència de material de diagnòstic per avaluar i febles senyals de sonda. Les mostres, que no es podien avaluar, tenien un nivell inferior i menor de Gleason.

En aquesta cohort d’homes diagnosticats amb càncer localitzat en població, la freqüència de fusió de TMPRSS2: ERG era del 15% (17/111). TMPRSS2: els tumors positius en fusió ERG eren més propensos a tenir una puntuació de Gleason més alta ( P a dues cares = 0, 01) (Taula 1). Per valorar la relació de l’estat de fusió i el càncer letal de pròstata, es va utilitzar una regressió d’incidència acumulada (Kalbfleisch i Prentice, 2002) per tenir en compte les causes de morts competitives amb el pas del temps. Es va observar una associació estadísticament significativa entre la presència de la TMPRSS2: fusió i metàstasis ERG o mort específica de la malaltia (Figura 1c) amb una proporció d’incidència acumulada (CIR) de 2, 7 ( P <0, 01, interval de confiança del 95% (CI) = 1, 3 –5, 8). A l’hora d’ajustar la puntuació de Gleason, el CIR era de 1, 8 ( P = 0, 2 i 95% CI = 0, 6–5, 3). Basat en l’homogeneïtat de la fusió de TMPRSS2: ERG en cèl·lules d’un tumor determinat (Perner et al., 2006) i la seva presència en càncer de pròstata invasor i aproximadament un 20% de càncer de pròstata d’alt grau amb fusió gènica associada (Perner et al., en premsa), creiem que es tracta d’un esdeveniment primerenc. Per valorar l'associació de la sobreexpressió ERG amb la fusió gènica en aquesta cohort basada en la població, es va realitzar QPCR per al gen ERG (ERG f: exon 5–6, CGCAGAGTTATCGTGCCAGCAGAT i ERG r: exona 5–6, CCATATTCTTTCACCGCCCACTCC) tal com es descriu recentment (Tomlins et al., 2005), en un subconjunt de 28 casos. TMPRSS2 12/12 : càncers de pròstata en fusió ERG en contrast amb càncers de pròstata 2/16 sense TMPRSS2: fusió ERG ( P <0, 0005) (figura 2). Així, el 86% dels casos de càncer de pròstata amb alta expressió d’ERG en aquest subconjunt tenien la fusió TMPRSS2: ERG . Aquest resultat confirma la nostra troballa anterior on es va demostrar que 19 de 20 casos de càncer de pròstata amb sobreexpressió ERG tenien reordenament TMPRSS2: ERG per seqüenciació (Tomlins et al., 2005).

Taula completa

Image

L'expressió ERG està associada a l'estat de fusió TMPRSS2: ERG . L'expressió de transcripció d'ADNc d'ERG es va determinar mitjançant QRT-PCR en temps real per a 28 mostres de càncer de pròstata extretes de la cohort en espera. Tots 12 càncers de pròstata TMPRSS2: fusió gènica ERG van demostrar l'expressió ERG. Només 2 de 16 TMPRSS2: casos de negació de fusió ERG van demostrar expressió ERG. Així, el 86% dels casos amb sobreexpressió ERG també alberguen la fusió gènica TMPRSS2: ERG . La relació de l'expressió de transcripció de ERG / gliceraldehid-3-fosfat deshidrogenasa (GAPDH) es va normalitzar a la línia cel·lular de Meg-01, que feia expressar ERG (eix y ). Si no es va identificar cap producte PCR ERG després de 40 cicles, es va considerar negatiu (és a dir, ERG / GAPDH = 0).

Imatge a mida completa

Curiosament, es va veure que l’expressió d’ERG alta era protectora en l’únic altre estudi del càncer de pròstata (Petrovics et al., 2005) que examina ERG, on s’associaven nivells elevats de transcripció d’ERG amb una menor incidència de fracàs bioquímic d’antigen específic de la pròstata (PSA). Els resultats de Petrovics cal considerar-los amb precaució, ja que el fracàs bioquímic és un punt final subrogat deficient per als punts finals clínicament significatius, inclosa la recaiguda clínica i la mort, com demostren tres estudis recents. Porter et al. (2006) va observar un 45, 5% de fracàs bioquímic de PSA en una sèrie de prostatectomia radical, però la mort específica del càncer de pròstata només es va produir en el 18, 5% de la població amb un temps de seguiment de fins a 25 anys. Carver et al., 2006, van informar sobre una població d’homes amb càncer de pròstata T3 que van patir prostatectomia radical, només el 36% amb fracàs bioquímic de PSA tenia progressió de la malaltia. Ward et al., 2003 van trobar que en una població de 3897 pacients amb prostatectomia radical, només el 8, 3% dels homes amb insuficiència bioquímica de PSA van morir de càncer de pròstata. Així, la fallada de PSA està associada a la mort específica del càncer de pròstata, però la majoria dels homes amb fracàs bioquímic de PSA morran per altres causes. Per tant, la relació entre TMPRSS2: estat de fusió ERG i mort de càncer de pròstata és molt més fiable.

La cohort Örebro Watchful Waiting representa una població ingènua de tractament extreta d’una zona de captació estrictament definida per a 190 000 habitants que viuen a Örebro. La freqüència de la fusió de TMPRSS2: ERG en aquesta atenta població és inferior al 55% (16/29) reportat per Tomlins et al. Soller et al. (2005) i 78% (14/18) (2006) i el 49, 2% (58/118) reportats per Perner et al. (2006). Aquestes diferències es podrien explicar pel percentatge més baix de casos de grau elevat en aquesta cohort d'espera vigilant en comparació amb els altres estudis no basats en població.

En resum, aquestes dades suggereixen que la fusió TMPRSS2: ERG pot contribuir a un fenotip de càncer de pròstata més agressiu i potser té en compte en part el càncer de pròstata de grau superior. A més, aquest estudi recolza el paper crític de l'ERG com a oncogeni en el càncer de pròstata.

Informació complementària

Documents de paraula

  1. 1.

    Dades suplementàries

    La informació complementària acompanya el document del lloc web d'Oncogene (//www.nature.com/onc).