Funcions xab2 en la progressió del cicle cel·lular mitòtic mitjançant la regulació transcripcional de cenpe | mort i malaltia cel·lular

Funcions xab2 en la progressió del cicle cel·lular mitòtic mitjançant la regulació transcripcional de cenpe | mort i malaltia cel·lular

Anonim

Temes

  • Teràpia contra el càncer
  • Senyalització cel·lular
  • Mitosi
  • Transcripció

Resum

La proteïna 2 que uneix Xeroderma pigmentosum (XPA) és una proteïna multifuncional que té un paper crític en processos que inclouen la transcripció, la reparació de l'ADN acoblat per la transcripció, el splicing de l'ARNm previ, la recombinació homòloga i l'exportació d'ARNm. L'anàlisi de microarray sobre l'expressió gènica en cèl·lules derrocadores XAB2 revela que molts gens amb un canvi significatiu en la funció d'expressió en la regulació del cicle cel·lular mitòtic. L’anàlisi d’escàner cel·lular activat per fluorescència va confirmar que l’esgotament de XAB2 va portar a la detenció cel·lular en fase G2 / M, principalment per fase o prometafase. La imatge de cèl·lules vives va revelar que la derrota de XAB2 va induir defectes mitòtics greus, incloent-hi la desalinització del cromosoma i els defectes en la segregació, provocant una aturada mitòtica, catàstrofe mitòtica i posterior mort cel·lular. Entre els principals gens regulats per l'esgotament de XAB2 es troba la proteïna E associada al centrosoma de la proteïna motora mitòtica (CENPE). CENPE es va mostrar fenotips similars a la pèrdua de XAB2, però el derrocament de CENPE seguit per l'esgotament de XAB2 no va millorar encara més la detenció del cicle cel·lular. El test de la luciferasa del promotor CENPE va demostrar que la sobreexpressió de XAB2 va augmentar l'activitat de la luciferasa, mentre que l'esgotament de XAB2 va provocar una reducció marcada de l'activitat de la luciferasa. El mapeig posterior va revelar una regió del promotor CENPE que es requereix per a la regulació transcripcional de XAB2. A més, el test ChIP va demostrar que XAB2 interactuava amb el promotor CENPE. En conjunt, aquests resultats donen suport a una nova funció de XAB2 en la regulació del cicle cel·lular mitòtic, que està parcialment mediada per la regulació de transcripció del CENPE.

Principal

La proteïna 2 que uneix Xeroderma pigmentósum (XPA) (XAB2) és un gen molt conservat, que es va identificar originalment en humans com a proteïna que interactuava amb XPA mitjançant un sistema de dos híbrids llevats. 1 El gen XAB2 humà està situat al cromosoma 19p13.2, que codifica una proteïna de 855 aminoàcids amb un pes molecular de 100 kDa. La proteïna XAB2 conté 15 motius de repetició tetratricopeptídics implicats en les interaccions proteïna-proteïna i en l’assemblea de complexos multiproteïnes. Té molts ortòlegs, com SYF1 a Saccharomyces cerevisiae , 2, 3 ATH55 a la rata 4 i Fandango a Drosophila. 5

Es va informar que XAB2 podia interactuar amb les proteïnes del grup A i B de la síndrome de Cockayne (CSA i CSB), així com amb l'ARN polimerasa II, i la regulació baixa de XAB2 mitjançant anticorp anti-XAB2 o siRNA van inhibir específicament la síntesi de l'ARN normal i la recuperació de la síntesi d'ARN. després de la irradiació UV, el que indica que XAB2 està implicat en la transcripció i reparació de l'ADN acoblat per la transcripció. 1, 6 Estudis posteriors van demostrar que XAB2 podria unir-se a una forma hiperfosforilada de l'ARN polimerasa II de manera dependent de la UV i CSA / CSB i contribuir a l'allargament de la transcripció. 6 A més, XAB2 està implicat com un component del complex 6 Prp19 / XAB2 (hAquarius, XAB2, Prp19, CCDC16, hISY1 i PPIE) o del complex 8 relacionat amb Prp19 / CDC5L requerit per a l'empalmament pre-mRNA. Durant el splicing, el complex Prp19 es recluta a l’espliceosoma i és crucial per a l’activació del spliceosoma mitjançant l’estabilització d’U5 i U6 amb l’espliceosoma després de la dissociació U4. 9, 10 A les cèl·lules Hela, es va informar que el complex Prp19 / XAB2 va associar-se amb l'ARN més que amb l'ADN, i la derrota de XAB2 inhibiria el splicing de Bcl-x pre-ARNm. 6 De la mateixa manera, SYF1, homòleg de XAB2 en el llevat, també s’identifica com un factor implicat en el splicing pre-ARNm, 2, 3 i un nou factor d’allargament de la transcripció enllaçant el complex Prp19 amb l’ARN polimerasa II a través del seu domini terminal C. 11

XAB2 també és essencial per a l’embriogènesi precoç del ratolí, perquè s’ha demostrat que l’abatiment de XAB2 en els ratolins condueix a una letalitat embrionària. 12 Es va demostrar prèviament que XAB2 podia interactuar amb el receptor d’àcid retinoic A i la histona deacetilasa 3, i la deficiència de XAB2 va augmentar la diferenciació cel·lular induïda per l’àcid retinoic (ATRA) en cèl·lules cancerígenes sensibles a l’ATRA i resistents. Aquests resultats suggereixen que XAB2 pot mostrar un efecte inhibidor en la diferenciació cel·lular induïda per ATRA. A més, XAB2 pot jugar un paper en la tumorigènesi. L’expressió XAB2 està regulada significativament en el càncer gàstric primari, 14 càncer de mama triple triple negatiu 15 i un supervivent a llarg termini d’un tumor teratoide / rabdoide atípic, 16 mentre està regulat en càncer d’ovari 17 i sarcoma 18 mitjançant base de dades Oncomine (www.oncomine .org). Les etiquetes XAB2SNPs (rs794078 i rs4134816) estan dramàticament correlacionades amb el risc de càncer de pulmó de cèl·lules no petites en la població xinesa. A més, els nivells de XAB2 es redueixen de manera impactant en les cèl·lules mare hematopoietiques envellides, cosa que suggereix un paper en l’envelliment. 20 Recentment, vam demostrar que XAB2 es presentava en la proteïna ribonucleo d’un element de consens que es troba en els ARNm naturalment intronless que poden promoure l’exportació d’ARNm i que la interrupció de XAB2 va comportar la retenció nuclear dels ARNm intronis, cosa que suggereix un paper de XAB2 en l’ARNm naturalment intronless. exportació. 21 Més recentment, s'ha informat que XAB2 regulava el pas de resecció final durant la reparació de recombinació homòloga de ruptures cromosòmiques de doble fil. Per tant, XAB2 és una important proteïna multifuncional.

Malgrat les funcions crítiques de XAB2 en l'expressió gènica, encara no es coneixen els gens objectiu descendent i els posteriors rols fisiològics en les cèl·lules humanes. Aquí, realitzem anàlisis de microarrays sobre cèl·lules Hela transfectades amb shARN XAB2, revelant que XAB2 modula l’expressió d’un nombre significatiu de gens, molt implicats en el cicle cel·lular i la progressió mitòtica. A més, demostrem que el derrocament de XAB2 provoca la desalinització i la segregació errònia dels cromosomes, l'estructura nuclear anormal, el pol del cargol i l'organització dels microtúbuls, provocant una aturada mitòtica, catàstrofe mitòtica i posterior mort cel·lular. L’anàlisi mecànica revela que el fenotip observat en cèl·lules d’esgotament de XAB2 està mediat per una proteïna motora similar a la kinesina anomenada proteïna E associada al centrosoma (CENPE), la transcripció de la qual està regulada per XAB2. En conjunt, les nostres dades indiquen que XAB2 regula la progressió mitòtica mitjançant control de transcripció de CENPE.

Resultats

L'anàlisi de Microarray revela que el derrocament de XAB2 resulta en una expressió aberrant de molts gens implicats en el cicle cel·lular mitòtic

Estudis anteriors van indicar que XAB2 és una proteïna multifuncional que té un paper crític en la transcripció, el splicing 6 i l'exportació d'ARNm. Per identificar gens objectiu regulats per XAB2, es va analitzar l'expressió gènica de cèl·lules HeLa esgotades de XAB2 per microarray. Aquesta anàlisi va revelar que un total de 690 gens van mostrar un canvi significatiu en l'expressió (> dues vegades més gran, P <0.05). Entre ells, 216 gens estaven regulats i 474 gens regulats a la baixa (Taula suplementària 1). L’eficàcia derrocadora de XAB2 es va confirmar tant per Western blot (Figura 1a) a nivell de proteïnes com per microarray a nivell d’ARNm (Taula suplementària 1, regulada a la baixa per 3.43 vegades). Per verificar les dades de microarray, RT-PCR es va utilitzar per comprovar el nivell d’expressió de diversos gens incloent MAPK4, SERPINB5, EPGN i PRG4. En consonància amb els resultats de microarray, es va confirmar l'expressió reduïda d'aquests quatre gens mitjançant RT-PCR (Figura Suplementària S1).

Image

L’anàlisi de Microarray revela els gens implicats en el cicle cel·lular i la progressió mitòtica com a grans gens amb canvis d’expressió després del cop d’abast XAB2. ( a ) Anàlisi de Ontologia gènica que mostra les funcions gèniques amb canvis significatius en l'expressió després de l'atac XAB2. Panell inferior dret: western blot que mostra XAB2 es va esgotar de manera eficient després que les cèl·lules fossin infectades amb lentivirus que contenia XAB2 shRNA. ( b ) Expressió diferencial de gens (> dos cops, P <0, 05) relacionada amb el cicle cel·lular i la progressió mitòtica després de la derrota de XAB2. ( c ) L’anàlisi RT-PCR va validar els nivells d’expressió gènica després del cop d’abast XAB2

Imatge a mida completa

A continuació, es va realitzar una anàlisi genètica de Ontologia per analitzar les funcions biològiques dels 690 gens amb expressió alterada. Com es mostra a la figura 1a, diverses funcions principals afectades van estar relacionades amb la regulació del cicle cel·lular, incloent el cicle cel·lular mitòtic, la fase M del cicle cel·lular mitòtic, la prometafase mitòtica i la divisió cel·lular. Per tant, es va desregular un conjunt de gens implicats en la regulació del cicle cel·lular (figura 1b), incloent CENPE, CKAP5, CLIP1, CDC27 i Mad2L1, l'expressió dels quals va ser validada per RT-PCR (figura 1c). En conjunt, aquestes dades van suggerir un paper crític de XAB2 en la mitosi i la regulació del cicle cel·lular.

La derrota XAB2 condueix a l'arrest mitòtic, a la catàstrofe mitòtica ia la mort cel·lular

Per investigar més si XAB2 regula el cicle cel·lular i la progressió mitòtica, es va fer un anàlisi de cèl·lules activades per fluorescència (FACS) en cèl·lules Hela transfectades amb shARN XAB2. Sorprenentment, la derrota de XAB2 va suposar un augment significatiu de cèl·lules arrestades en fase G2 / M (32, 8% en cèl·lules transfectades de shRNA XAB2 en comparació amb el 10, 6% en control, P <0, 001, figures 2a i b). Per descartar els efectes fora de la destinació del shRNA XAB2, es va provar un altre shRNA i dos siRNAs per als seus efectes sobre el cicle cel·lular. De la mateixa manera, la derrota de XAB2 mitjançant diferents shRNA o siRNA va suposar una aturada significativa del cicle cel·lular en fase G2 / M tant en cèl·lules Hela (figura suplementària S2A) com en cèl·lules 293T (figura suplementària S2B), cosa que indica que la detenció del cicle cel·lular és un defecte important després de l'esgotament de XAB2. Consistentment, l’expressió dels marcadors mitòtics Cyclin B1 i Phospho-HistoneH3 (Ser10) es va veure aparentment augmentada en les cèl·lules derrocadores XAB2 mitjançant Western blot (Figura 2c) i l’anàlisi FACS (figura suplementària S2C).

Image

La deficiència de XAB2 provoca arrest mitòtic, catàstrofe mitòtica i mort cel·lular. ( a ) L'esgotament de XAB2 dóna lloc a l'acumulació de cèl·lules G2 / M mitjançant anàlisi FACS. Les cèl·lules Hela es van transfectar amb shRNA control (shNC) o shABNA XAB2 (shXAB2) i després es van tacar amb PI per a l'anàlisi de la distribució del cicle cel·lular. ( b ) Quantitat de cèl·lules en diferents fases del cicle cel·lular després de l'esgotament de XAB2 ( n = 3); *** P ≤0, 001. ( c ) Western blot revela una regulació superior de CyclinB1 i Fosfo-HistoneH3 (Ser10) en cèl·lules esgotades de XAB2. ( d ) La derrota de XAB2 indueix un augment significatiu de cèl·lules en la fase i la prometafase. Les cèl·lules Hela es van transfectar amb shRNA control (shNC) o shABNA XAB2 (shXAB2) i després es van inmunitzar amb anticorp α -tambulina i DAPI. ( e ) Quantitat de cèl·lules mitòtiques en diferents fases després de l'esgotament de XAB2. Es van comptabilitzar més de 100 cèl·lules mitòtiques seleccionades aleatòriament ( n = 3). ( f ) Les imatges de cèl·lules vives que mostren un colpeig de XAB2 van provocar una detenció mitòtica i la mort cel·lular. ( g ) Quantitat de la durada mitjana de la mitosi de les cèl·lules Hela GFP-H2B amb control o eliminació XAB2 ( n = 30 cèl·lules); *** P ≤0.001 (NEB: avaria nuclear). ( h ) Quantitat de cèl·lules en aturada mitòtica o retard mitòtic (durada de la mitosi> 90 min) tal com s'observa en imatges a cèl·lules vives. La durada de la mitosi es defineix com el lapse de temps des de la ruptura de l’envoltament nuclear fins a l’aparició de l’anafase o la mort cel·lular; *** P ≤0, 001. ( i ) Quantitat de cèl·lules mortes mitòtiques després de l'esgotament de XAB2. Es van comptabilitzar més de 50 cèl·lules mitòtiques seleccionades aleatòriament ( n = 3); *** P ≤0, 001. ( j ) La derrota de XAB2 provoca apoptosi per anàlisi FACS mitjançant la tinció de l'annexina V i la PI. ( k ) Quantitat de cèl·lules positives de l'annexina V després de l'esgotament de XAB2 ( n = 3); ** P ≤0, 01

Imatge a mida completa

A continuació, les cèl·lules derrocadores XAB2 i les cèl·lules de control es van tacar amb anticorp contra la tubulina i DAPI, es van observar cèl·lules mitòtiques significatives arrestades per fase i prometafase en cèl·lules amb esgotament de XAB2 (82, 8 versus 15, 1% en control, P <0, 001, Figures 2d i e), encara més suport de defectes greus en la progressió del cicle cel·lular mitòtic.

Per investigar millor la funció de XAB2 en la progressió mitòtica, vam esgotar XAB2 a les cèl·lules HeLa expressant de manera estable GFP-H2B i vam fer un seguiment de la mitosi mitjançant imatges de cèl·lules vives. Tal com es mostra a la figura 2f, dos nuclis fills es van separar 50 min i la mitosi es va completar en 70 min a les cèl·lules control. En canvi, la separació de nuclis no es va observar ni tan sols 300 min en cèl·lules esgotades de XAB2. L’anàlisi estadística va revelar a més que el temps mitjà de durada de la mitosi des del trencament de l’embolcall nuclear fins a l’anafase es va perllongar des de ~ 60 min en cèl·lules de control fins a 290 min en cèl·lules amb esgotament de XAB2 (Figura 2g, P 90 min) va augmentar dramàticament de 4, 9 a 81, 2% ( Figura 2h, P <0, 001). A més, les cèl·lules que van patir la mort de cèl·lules mitòtiques es van incrementar de forma significativa després del cop del XAB2 del 3, 9 al 65, 8% (Figura 2i, P <0, 001). Per comprovar més si la mort cel·lular va induir la derrota de XAB2 després de la catàstrofe mitòtica, es va realitzar una anàlisi FACS després de la tinció de l'annexina V i de iòdur de propidi (PI). Tal com es mostra a les figures 2j i k, el percentatge de cèl·lules positives de l’annexina V va augmentar òbviament en les cèl·lules derrocadores XAB2 del 5, 8 al 24, 7%, cosa que suggereix la mort cel·lular important després de l’esgotament de XAB2. En conjunt, aquestes dades van indicar que la deficiència de XAB2 va derivar en detenció mitòtica, catàstrofe mitòtica i mort cel·lular.

La derrota XAB2 provoca defectes de segregació i alineació del cromosoma

Com que la mitosi requereix un control estricte del moviment dels cromosomes, seguidament vam realitzar una tinció de DAPI per determinar si XAB2 afecta l’alineació i la segregació dels cromosomes. Aquesta anàlisi va revelar una mala alineació cromosòmica en plaques equatorials i ponts interns de DNA (figura 3a).

Image

La derrota de XAB2 condueix a la desordenació i la desregregació errònia dels cromosomes. ( a ) Els cromosomes i els ponts internuclears mal alineats / mal alineats observats a les cèl·lules esgotades de XAB2. ( b ) Les imatges de cèl·lules vives que mostren un derrocament de XAB2 van donar lloc a detenció mitòtica, retard mitòtic i defecte de segregació. ( c ) La quantitat de cèl·lules mitòtiques després de l'esgotament de XAB2 va mostrar un augment significatiu de la detenció mitòtica, del retard mitòtic i del defecte de segregació

Imatge a mida completa

Consistent amb l'observació prèvia, la majoria de les cèl·lules mitòtiques mostraven arrest mitòtic, retard mitòtic o defecte de segregació. Concretament, es va observar la detenció mitòtica en fase o prometafase amb defectes en l'alineació dels cromosomes en el 43, 1% de les cèl·lules mitòtiques després de l'esgotament de XAB2 en comparació amb el 2, 6% en el control, que no es va dividir i va acabar amb la mort de les cèl·lules (figures 3b i c). Es va observar un retard mitòtic en un 33, 2% de cèl·lules mitòtiques després del derrocament de XAB2 enfront del 4, 2% de control, aquestes cèl·lules encara es van poder dividir després d’un retard mitòtic amb la desalinització del cromosoma, però també amb un defecte de segregació cromosòmica que va provocar la formació de ponts d’ADN internuclears (Figures 3b i c). Mentre que un defecte de segregació sense desajustament dels cromosomes també es va observar en el 16, 3% de les cèl·lules mitòtiques en comparació amb el 6, 9% en el control (Figures 3b i c). Les dues cèl·lules amb retard mitòtic o defecte de segregació mostraven una estructura nuclear anormal i van morir en la progressió del cicle cel·lular (figura 3b). Aquestes dades van indicar defectes greus en l’alineació i segregació del cromosoma després del derrocament de XAB2.

La deficiència de XAB2 indueix un pol anormal de fus, estructura nuclear i organització de microtúbuls i ruptures d'ADN

A continuació, es va procurar aprofundir sobre com es molesta la mitosi a les cèl·lules derrocadores de XAB2. Primer, es va comprovar el pol de l’eix en les cèl·lules esgotades de XAB2 ja que es requereix una formació correcta de l’eix per a l’alineació i segregació de cromosomes. Sorprenentment, es van observar pols de fus únic o múltiples en ~ 30 i ~ 8% de les cèl·lules de profase / prometafase després de l'atac a XAB2 mitjançant la tintura de tubulina o Aurora A (figures 4a i b). En segon lloc, es van observar estructures nuclears anormals incloses les bombes nuclears, la forma de cacauet o el nucli irregular a la majoria de les cèl·lules de la interfase després de l'esgotament de XAB2 (Figura 4c). Mentrestant, l'organització dels microtúbuls també es va veure intensament alterada. Es va observar un conjunt irregular de microtúbuls en un costat del nucli en comparació amb una distribució uniforme en cèl·lules de control (figura 4c). En tercer lloc, es van examinar els danys de l'ADN en les cèl·lules derribades de XAB2, ja que generalment les bombes nuclears estan associades a ruptures d'ADN. 23, 24 Tal com es mostra a les figures 4d i e, l'expressió del marcador de danys en l'ADN Phospho-Histone H2A.X ( γ- H2A.X) es va incrementar significativament en les cèl·lules derrocades de XAB2, tant per la tinció d'immunofluorescència com per l'anàlisi de blot occidental. En conjunt, aquestes dades suggereixen que XAB2 era crític per a l’organització dels microtúbuls i fusos, així com per a l’estabilitat del genoma.

Image

El derrocament de XAB2 produeix un pol de cargol aberrant, una organització interrompuda dels microtúbuls i un major dany en l'ADN. ( a, b ) L'esgotament de XAB2 condueix a pols de fus únics o múltiples a cèl·lules de prophasa o de prometafase. Les cèl·lules Hela es van transfectar amb shRNA control (shNC) o shABNA XAB2 (shXAB2) i després es van inmunitzar amb anticorp α -tambulina ( a ) o anticorpi Aurora A ( b ) i DAPI. ( c ) Distracció de l'organització i estructura nuclear dels microtúbuls a les cèl·lules interfàsiques després de l'enderrocament de XAB2. Les cèl·lules Hela es van immunostenir amb anticorp α -tambulina (verd) i DAPI (blau). ( d ) La derrota de XAB2 produeix un augment de les ruptures d'ADN com es mostra en immunostaining amb anticorp γ- H2A.X (verd). ( e ) Western blot revela la regulació de γ- H2A.X a les cèl·lules derrocadores XAB2

Imatge a mida completa

CENPE media el defecte de la progressió mitòtica en les cèl·lules d'esgotament de XAB2

A continuació, vam proposar explorar el mecanisme sobre com XAB2 regula la mitosi. Vam observar que el CENPE, un factor clau en la mitosi, es trobava entre els gens més baixos regulats en els resultats de microarrossegament XAB2. Per tant, vam provar la hipòtesi que XAB2 regula la mitosi mitjançant CENPE. En primer lloc, es va verificar el nivell d’expressió de CENPE a les cèl·lules esgotades de XAB2 mitjançant RT-PCR i l’anàlisi de Western blot, els resultats van indicar que l’esgotament de XAB2 va provocar una pèrdua dramàtica de CENPE tant a nivell d’ARNm com a nivell de proteïna (Figures 1c i 5a, Figura suplementària S3) . Mentre que el descompte CENPE no va mostrar cap efecte en l'expressió de proteïna XAB2, cosa que suggereix que les funcions XAB2 aigües amunt de CENPE (Figura 5b). A continuació, es va esgotar el CENPE a les cèl·lules HeLa mitjançant siRNA específic del CENPE, l'esgotament va conduir al 50, 0% de les cèl·lules arrestades en fase G2 / M en comparació amb el 19, 0% en control (figures 5c i d, P <0, 001). Mentrestant, l'esgotament de CENPE també va induir la desalinització del cromosoma i la detenció de profase / prometafase (78, 1% en cèl·lules derrocades contra 17, 2% de control), similar al fenotip observat en cèl·lules amb deficiència de XAB2 (Figures 5e i f). Per confirmar més si XAB2 regula la mitosi mitjançant CENPE, les cèl·lules HeLa van ser tractades amb CENPE siRNA seguit de l'esgotament de XAB2. Tal com es mostra a la figura 5g, el derrocament de CENPE solament va detenir dramàticament les cèl·lules en fase G2 / M, mentre que la derrota de CENPE seguida del tractament amb XRNA amb shRNA no va millorar encara més l’aturada de G2 / M causada pel CENPE, que il·lustra l’important paper de CENPE en el control de la progressió mitòtica. induït per l'esgotament de XAB2. En conjunt, aquests resultats van suggerir que XAB2 regulés la mitosi mitjançant CENPE.

Image

XAB2 regula la progressió mitòtica mitjançant CENPE. ( a ) Western blot que mostra una disminució de l’expressió de la proteïna CENPE a les cèl·lules derrocadores XAB2. ( b ) Western blot que demostrava un knockdown de CENPE no va canviar el nivell de proteïna XAB2. ( c ) La derrota de CENPE condueix a la detenció de G2 / M tal com es revela l'anàlisi FACS. Les cèl·lules Hela es van transfectar amb siRNA de control (siNC) o CENPE siRNA (siCENPE) i després es van tacar amb PI per analitzar la distribució del cicle cel·lular. ( d ) Quantitat de cèl·lules en diferents fases del cicle cel·lular després de l'esgotament del CENPE ( n = 3); *** P ≤0, 001. ( e ) La coloració per immunofluorescència mostra un augment significatiu de cèl·lules en la fase i la prometafase després del derrocament de CENPE. Les cèl·lules Hela es van transfectar amb siRNA de control (siNC) o CENPE siRNA (siCENPE) i després es van inmunitzar amb anticorp α -tabulina i DAPI. ( f ) Quantitat de cèl·lules mitòtiques en diferents fases després de l'esgotament del CENPE. Es van comptabilitzar més de 50 cèl·lules mitòtiques seleccionades aleatòriament ( n = 3). ( g ) El colpeig de CENPE seguit pel tractament amb shARN de XAB2 no augmenta encara més la detenció de G2 / M induïda per l'esgotament del CENPE. ( n = 3); * P 0.05

Imatge a mida completa

XAB2 regula l'expressió CENPE a nivell de transcripció

A continuació, vam investigar com XAB2 podria regular l'expressió CENPE. Anteriorment, es va informar que XAB2 interactuava amb l'ARN polimerasa II i va tenir un paper en la transcripció, 1, 6, a més, es va observar que l'esgotament de XAB2 conduïa a la reducció de CENPE a nivell d'ARNm en aquest estudi, cosa que suggereix que XAB2 pot regular transcripcionalment l'expressió de CENPE. Per provar-ho, primer hem construït un reporter de luciferasa que abastava una regió de 1355 pb de -1263 a +92 del lloc inicial de transcripció de CENPE. Com es mostra a la figura 6a, aquesta regió podria impulsar la transcripció de la luciferasa, suggerint que serviria com a promotor CENPE. La sobreexpressió de XAB2 va augmentar l'activitat promotora de CENPE en 1, 8 vegades (figura 6a), mentre que el derrocament de CENPE va donar lloc a una disminució marcada de l'activitat de la luciferasa per 7, 2 vegades (figura 6b). La sobreexpressió i l'eficàcia de colp de XAB2 es van confirmar mitjançant l'anàlisi de Western Blot (Figura 6c).

Image

XAB2 regula l'expressió CENPE a nivell transcripcional. ( a ) El test de la luciferasa revela que la sobreexpressió de XAB2 augmenta l'activitat promotora de CENPE. Cntl: control, OE: sobreexpressió ( n = 3); * P 0.05. ( b ) El test de la luciferasa que mostra la derrota de XAB2 disminueix l'activitat del promotor CENPE. ( n = 3); *** P 0.001. ( c ) Western blot mostra la sobreexpressió i l'eficàcia de colp de XAB2. ( d ) L'assaig de luciferasa de construccions de supressió en sèrie del promotor CENPE condueix a la identificació de la regió principal del promotor CENPE. ( e ) Efecte de la derrota de XAB2 sobre les constructes d’eliminació del promotor CENPE mitjançant assaig de luciferasa ( n = 3); ns, sense importància, * P 0.05, ** P 0.01, *** P 0.001. ( f ) El test ChIP mostra que XAB2 interacciona amb el promotor CENPE

Imatge a mida completa

Per identificar la regió mínima del promotor CENPE requerida per a la regulació XAB2, hem generat una sèrie de construccions de supressió. La transfecció d'aquestes construccions a cèl·lules HeLa va indicar que la regió -208/92 va mostrar una activitat luciferasa propera al promotor de longitud completa (figura 6d). A més, la regió –1263 / −209 no tenia activitat promotora (figura 6d), cosa que suggereix que el promotor principal abasta uns 300 pb de –208 a 92. La transfecció de les construccions d’eliminació seguides del derrocament de XAB2 va revelar que l’esgotament de XAB2 va suposar una disminució important del l'activitat luciferasa per al promotor de longitud completa −1263/92 o les construccions de supressió −808/92 i −408/92, mentre que la supressió posterior −208/92 va comportar una reducció molt menor i es va abolir la disminució per a una construcció −58/92 (Figura 6e), cosa que suggereix que la regió entre -408 / −59 és crítica per a la regulació transcripcional de l'expressió CENPE de XAB2. La immunoprecipitació de cromatina (ChIP) de proteïna XAB2 etiquetada per HA també va revelar un enriquiment significatiu de XAB2 al promotor de CENPE (figura 6f). En conjunt, aquestes dades admeten que XAB2 regula transcripcionalment l'expressió de CENPE.

Discussió

XAB2 és un component del complex Prp19, que s'ha informat que funciona en reparació d'ADN acoblat per transcripció, empalmament pre-ARNm, exportació d'ARNm, transcripció i recombinació homòloga. En aquest estudi, es va informar d'una nova funció de XAB2 com a regulador del cicle cel·lular mitòtic.

Per obtenir una visió profunda de l'impacte de la deficiència de XAB2, es va realitzar una anàlisi de microarrays sobre l'expressió gènica després de l'esgotament de XAB2 a les cèl·lules HeLa. Sorprenentment, aquesta anàlisi va revelar que l’expressió de molts gens que funcionaven en el cicle cel·lular o la regulació de la mitosi es va canviar significativament. A més, vam demostrar que la deficiència de XAB2 va induir la desalinització i la segregació errònica del cromosoma, l'estructura nuclear anormal, el pol del cargol i l'organització de microtúbuls, amb resultat d'una aturada mitòtica, catàstrofe mitòtica i posterior mort cel·lular, cosa que indica un paper crític de XAB2 en la regulació del cicle cel·lular mitòtic. Els nostres resultats són consistents amb els fenotips de la derrota de XAB2 documentada a la base de dades MITOCHECK (www.mitocheck.org), incloent retard de la metafase, problemes d'alineació de la metafase i morts cel·lulars. 25

En comprendre com afecta el XAB2 al cicle de cèl·lules mitòtiques, CENPE va resultar ser un dels principals genes amb una important reducció de l’expressió després del cop d’abast de XAB2. CENPE és una proteïna motora de cinetocorò més directa dirigida a la finalitat que pertany a la subfamília kinesina-7 i que ha estat estudiada àmpliament. Es recluta per primer cop al cinetocor durant la prometafase depenent de proteïnes com BubR1, 26 CENPF, 26 NUF2, 27 SEPT7, 28 TRAMM 29 i CTCF, 30 i després degradada per APC / C i SCF al final de la mitosi. 31, 32 CENPE és una proteïna molt gran d’uns 312 kDa amb múltiples dominis de funcions, incloent-hi un domini motor depenent de l’ATP N-terminal, un domini de coil-coil, un domini d’unió del cinetocor C-terminal i una unió de microtúbuls C-terminal. domini. 26, 30 Els treballs anteriors han suggerit que el CENPE juga un paper important en la congressió del cromosoma durant la prometafase, 33, 34, la formació d'unió estable entre els microtúbuls de fus i els cinetocorurs, des de la prometapa fins a l'anafase, 35, 36 i l'allargament del microtúbul. 37 A més, el CENPE també és essencial per a regular la SAC, probablement modulant les activitats de BubR1. 38, 39, 40, 41 La desregulació del CENPE mitjançant diversos mètodes de diferents tipus i espècies cel·lulars condueix constantment a la desalinització dels cromosomes i a la posterior progressió mitòtica. 33, 34, 38, 40, 42, 43, 44 Tanmateix, mostren destins cel·lulars diversos, amb alguns que causen detenció mitòtica a llarg termini, 40, 42, que tenen com a resultat una desregregació cromosòmica després d’un retard mitòtic, 38, 43, 44 i alguns. fins i tot provocant la mort cel·lular per apoptosi. 33

Així, es va provar la possibilitat que XAB2 reguli el cicle cel·lular mitòtic mitjançant CENPE. De fet, l'esgotament de XAB2 va provocar una disminució dramàtica del CENPE tant a nivell d'ARNm com a proteïna. D’acord amb els informes anteriors, l’esgotament del CENPE va donar lloc a fenotips similars als observats per a l’abatiment de XAB2, incloent la desalinització dels cromosomes i l’aturada mitòtica. A més, el colpeig de CENPE seguit pel tractament amb shARN de XAB2 no va canviar la detenció G2 / M causada per CENPE. Aquests resultats suggereixen que XAB2 funciona aigües amunt de CENPE i pot regular la progressió del cicle cel·lular mitòtic mitjançant CENPE.

A més, vam demostrar que XAB2 s'uneix al promotor de CENPE i regula la seva expressió mitjançant ChIP i test de luciferasa. La sobreexpressió de XAB2 va provocar una major activitat luciferasa mentre que l'esgotament de XAB2 va provocar una disminució marcada de l'activitat de la luciferasa. Un informe anterior va demostrar que XAB2 interacciona amb l'ARN polimerasa II i té un paper en la transcripció, principalment modulant l'allargament de la transcripció. 6, 10 Com que el complex XAB2 (hAquarius, XAB2, Prp19, CCDC16, hISY1 i PPIE) s'ha informat que s'uneixen a l'ARN, però no ADN in vitro i XAB2 conté 15 motius de repetició tetratricopeptídics implicats en interaccions proteïna-proteïna, però sense dominis d'unió a ADN., és molt probable que XAB2 fos reclutat al promotor de CENPE per altres proteïnes.

Tanmateix, en l'experiment de rescat de CENPE, no vam observar cap restauració significativa de la detenció del cicle cel·lular quan es va tornar a expressar CENPE després de l'esgotament de XAB2 (dades no mostrades). Intrigant, la re-expressió de CENPE després del seu propi cop de puny en les cèl·lules Hela no va poder revertir l’aturada del cicle cel·lular (dades no mostrades). Una possible explicació d’aquestes observacions pot incloure que el nivell de sobreexpressió no és prou alt com per compensar l’esgotament a causa de l’elevat pes molecular de CENPE (312 kDa) o que el fenotip induït per la deficiència de CENPE és greu i irreversible. A més, no podem excloure la possibilitat que l'efecte de l'esgotament de XAB2 estigui mediat per defectes de múltiples gens, tal com revela l'anàlisi de microarrays que un subconjunt de gens implicats en el cicle cel·lular i la progressió mitòtica estan regulats.

La mitosi és un dels processos crítics del cicle cel·lular per a una segregació cromosòmica adequada durant la divisió cel·lular. La desregulació de mitosi provoca sovint inestabilitat del genoma o aneuploïdia, condueix a catàstrofes mitòtiques i mort cel·lular i està estretament relacionada amb càncers i moltes altres malalties. Així, s’ha proposat l’orientació a la mitosi com a estratègia terapèutica atractiva per a la teràpia contra el càncer, per exemple, 45, 46, per exemple, l’inhibidor de CENPE com GSK923295, 47 sintelina 48 o PF2721 49 es considera ara que tenia activitat antitumoral. Per tant, serà interessant investigar si XAB2 pot servir com a nou objectiu anti-mitòtic per a la teràpia contra el càncer.

Materials i mètodes

Construeix i anticossos

La construcció de XAB2 es va comprar a Origene i es va tornar a clonar en un vector modificat pcDNA3.1 (Promega, EUA) que contenia l'etiqueta HA a l'extrem 5 ′. Un fragment de regió de 5 ′ de 1355 pb que s’estén de -1263 a 92 (+1 és el lloc d’inici de la transcripció) del gen CENPE humà va ser amplificat per PCR a partir de l’ADN genòmic d’Hela i clonat en un vector bàsic pGL3 (Promega) a KpnI / HindIII llocs. Les construccions d’eliminació del promotor CENPE es van amplificar a partir de la construcció del promotor de tota la longitud utilitzant PCR imbricada. Les seqüències de tots els construccions es van confirmar per seqüenciació directa. Les seqüències de primer s'enumeren a la taula complementària 2.

Anticòs policlonal contra XAB2 (Proteintech, Wuhan, Xina, 1: 800), Fosfo-Histona H3 (Ser10) (CST, MA, EUA, 1: 1000), Cdc2 (CST, 1: 2000), Histone H2A.X (Proteintech, 1: 1000), Fosfo-Histona H2A.X ( γ- H2A.X) (CST, 1: 800), anticossos monoclonals contra l'etiqueta HA (Covance, MA, EUA, 1: 2000), CyclinB1 (CST, 1: 2000), CENPE (Abcam, MA, Estats Units, 1: 1000) i α -tubulina (Sigma, Alemanya, 1: 5000) es van utilitzar en taques occidentals.

Cultiu cel·lular i interferència d’ARN

Les cèl·lules HeLa i 293T eren regals del Reed Lab de la Harvard Medical School, les cèl·lules MDA-MB-231 es van comprar a la American Type Culture Collection (Manassas, VA, EUA). Totes les cèl·lules es van cultivar en un medi d'àguila modificat amb dolçó complementat amb un sèrum boví fetal al 10%.

Per a la derrota genètica mediada per siRNA, les cèl·lules es van xapar en una placa de sis pous i es van transfectar 2 µl siRNA a 50 μ M mitjançant Lipofectamine 3000. Les cèl·lules van ser tractades amb CENPE siRNA o XAB2 siRNA per a anàlisis 24 o 55 h, respectivament, després de la transfecció. Es va informar anteriorment siRNA CENPE i XAB2 siRNA, 22, 50 siRNA no objectiu (RiboBio, Xina) es van utilitzar com a control negatiu. Les seqüències siRNA són les següents: CENPE siRNA (5′-CCACUAGAGUUGAAAGAUAdTdT-3 ′), XAB2-siRNA-1 (5′-CCAAUUCUCUGUCAAAUGCdTdT-3 ′), XAB2-siRNA-2 (5′-ACGCAGCACCUC)

Per a la derrota genètica mediada per shRNA, es van produir lentivirus que expressen shRNA XAB2 de la manera següent: es van col·locar 293T cèl·lules en un plat de 6 cm i es van transferir amb 1, 4 μ g de shRNA XAB2 (clonat a PLKO.1), 1, 4 μ g de pREV, 1, 4 μ g de pGag / Pol / PRE i 0, 7 μ g de pVSVG. Per controlar, substituir la construcció de shRNA XAB2 pel vector de control. Sis hores després de la transfecció, la barreja es va substituir per un medi d'àguila modificat amb dolçó fresc que contenia un 10% de FBS i es van cultivar cèl·lules durant 48 hores addicionals. A continuació, es va filtrar el medi que contenia lentivirus i es va emmagatzemar a -80 ° C. Pel que fa a la infecció amb lentivirus, les cèl·lules cultivades en placa de sis pous van ser infectades dues vegades amb lentivirus que contenia 6 μ g / ml polibrè durant un total de 48 h. Per a anàlisis de microarray, western blot, immunofluorescència, RT-PCR i distribució del cicle cel·lular, es van collir cèl·lules després del cultiu en medi fresc durant 24 hores més. Per a l'anàlisi de la mort cel·lular, les cèl·lules es van collir 48 hores després. The full sequence of XAB2 shRNA-1 and XAB2 shRNA-2 are CCGGGCTTCGCTACATCGAGTTCAACTCGAGTTGAACTCGATGTAGCGAAGCTTTTTG and CCGGGCAGTATGACATGTTCAACATCTCGAGATGTTGAACATGTCATACTGCTTTTTG, respectively. XAB2 shRNA-1 was used in the XAB2 knockdown experiments in this study unless otherwise indicated.

Microarray gene expression analysis

Hela cells were plated in six-well plate and infected twice with control or XAB2 shRNA lentivirus. Then cells were harvested and total RNA was isolated using RNeasy plus kit (Qiagen, Germany) following the manufacturer's instruction. The integrity of total RNA was monitored with Agilent 2100 Bioanalyzer. Microarrays were performed using Human Transcriptome Array 2.0 (Affymetrix, USA) with three independent experiments. Results were analysed by using the Transcriptome Analysis Console from Affymetrix. Only genes that had a 2-fold increase or decrease in expression with a significance of P <0.05 were included in the final results. Functional analysis of the genes with expression significantly changed by XAB2 knockdown was performed using Gene Ontology analysis.

FACS analysis

To examine the cell cycle distribution, cells were harvested and fixed in 75% ethanol at 4 °C overnight, washed twice with PBS, and then incubated with PI (Sigma) solution containing RNase for 30 min. The flow cytometry analysis was conducted on ACCURIC6, and the data were analysed using FlowJo7.6 software.

For cell death analysis, cells were stained using annexin/PI staining kit (KeyGEN BioTECH, Nanjing, China) for detection according to the manufacturer's instructions.

To detect the fraction of phospho-Histone H3 Ser10 positive cells, cells were fixed by 75% ethanol, permeabilized by 0.25% Triton X-100, and then stained with Alexa Fluor488-conjugated phospho-Histone H3 Ser10 antibody (1:50, CST) and PI.

Immunofluorescència

Cells were grown in 35 mm cell culture dish with glass bottom (NEST, Wuxi, China), fixed with 4% paraformaldehyde (Sigma, Germany) for 30 min, followed by permeabilization with 0.5% Triton X-100 for 10 min at room temperature. Cells were then incubated with α -tubulin antibody (1:250) diluted in PBS with 10% calf serum at 4 °C overnight, and immunostained with Alexa 488-labeled anti-mouse antibody (1:500) diluted in the same buffer at room temperature for 30 min, followed by DAPI staining and four washes with PBS for 5 min each. Fluorescence was detected using DMI6000 microscope (Leica, Germany).

Live cell imaging

GFP-H2B HeLa cells were a gift from Dr Huiyan Li in China National Center of Biomedical Analysis and were placed in 35 mm cell culture dish with glass bottom (NEST). Twenty-four hours after second infection with control or XAB2 shRNA lentivirus, images were captured every 10 min for 48 h using DMI6000 microscope (Leica) equipped with a × 40 objective lens in a chamber maintained at 37 °C with 5% CO 2 .

Transfection and luciferase assay

Cells were seeded into 12-well plate the day before transfection. 1 μg of firefly luciferase constructs were transfected using lipofectamine 2000. The pRL-TK plasmid (100 ng/sample) encoding Renilla luciferase was cotransfected, and the readout was used for normalization of firefly luciferase activity. Cells were harvested 24 h after transfection and luciferase activity was measured with Dual-Luciferase Reporter Assay Kit (Promega). All transfections were performed in triplicate.

To assess the effect of XAB2 overexpression or knockdown on CENPE promoter activity, Hela cells in 12-well plates were transfected with XAB2 construct for 24 h or infected twice with lentivirus containing XAB2 shRNA, followed by co-transfection of CENPE promoter construct and pRL-TK vector, cells were then harvested after 24 h for the measurement of luciferase activity.

ChIP

The ChIP assay was performed using EpiQuik Chromatin Immunoprecipitation Kit from Epigentek Group Inc. (Brooklyn, NY, USA) according to the manufacturer's protocol. Protein-DNA complexes were immunoprecipitated with HA antibody, and normal mouse IgG was used as negative control. Primer sets for CENPE were shown in Supplementary Table 2.

Estadístiques

Data were presented as mean±sd (standard deviation). Statistical analyses between two groups were performed using Student's t -test with statistical significance defined as * P <0.05, ** P <0.01 and *** P <0.001.

Informació complementària

Fitxers PDF

  1. 1.

    Figura suplementària S1

  2. 2

    Figura suplementària S2

  3. 3.

    Figura suplementària S3

  4. 4.

    Taula suplementària S1

  5. 5.

    Taula complementària S2

Glossari

XPA

xeroderma pigmentosum group A

XAB2

XPA-binding protein 2

CSA

Cockayne syndrome group A

ATRA

all-trans retinoic acid

CENPE

centrosome-associated protein E

FACS

fluorescence-activated cell scanner

γ -H2A.X

Phospho-Histone H2A.X

ChIP

chromatin immunoprecipitation

sd

standard deviation

La informació complementària acompanya aquest treball al lloc web de la mort i la malaltia cel·lular (//www.nature.com/cddis)